ID: 1200970753

View in Genome Browser
Species Human (GRCh38)
Location Y:9150077-9150099
Sequence CCTACAATTTAAAACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200970753_1200970758 27 Left 1200970753 Y:9150077-9150099 CCCACCAAGTTTTAAATTGTAGG No data
Right 1200970758 Y:9150127-9150149 GTAAGAGCATCTCAGTCAGTAGG 0: 4
1: 25
2: 24
3: 46
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200970753 Original CRISPR CCTACAATTTAAAACTTGGT GGG (reversed) Intergenic
No off target data available for this crispr