ID: 1200970788

View in Genome Browser
Species Human (GRCh38)
Location Y:9150398-9150420
Sequence GTGCTGCTTGAACAGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200970781_1200970788 30 Left 1200970781 Y:9150345-9150367 CCATCTAGTTTGTTGAATTCCTG No data
Right 1200970788 Y:9150398-9150420 GTGCTGCTTGAACAGTCATGGGG No data
1200970784_1200970788 7 Left 1200970784 Y:9150368-9150390 CCTGAATAGAACTAAGAGTGGTC No data
Right 1200970788 Y:9150398-9150420 GTGCTGCTTGAACAGTCATGGGG No data
1200970782_1200970788 11 Left 1200970782 Y:9150364-9150386 CCTGCCTGAATAGAACTAAGAGT No data
Right 1200970788 Y:9150398-9150420 GTGCTGCTTGAACAGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200970788 Original CRISPR GTGCTGCTTGAACAGTCATG GGG Intergenic