ID: 1200970854

View in Genome Browser
Species Human (GRCh38)
Location Y:9150850-9150872
Sequence CAGTGGTGCTAGAGGAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200970845_1200970854 9 Left 1200970845 Y:9150818-9150840 CCAAGACCAGCTCAGTCAGGGAA 0: 3
1: 28
2: 112
3: 189
4: 364
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data
1200970846_1200970854 3 Left 1200970846 Y:9150824-9150846 CCAGCTCAGTCAGGGAACCCCTA No data
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data
1200970840_1200970854 29 Left 1200970840 Y:9150798-9150820 CCCATGATGGACGCCACTTGCCA No data
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data
1200970842_1200970854 16 Left 1200970842 Y:9150811-9150833 CCACTTGCCAAGACCAGCTCAGT 0: 8
1: 30
2: 49
3: 79
4: 187
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data
1200970841_1200970854 28 Left 1200970841 Y:9150799-9150821 CCATGATGGACGCCACTTGCCAA 0: 5
1: 5
2: 11
3: 16
4: 90
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data
1200970839_1200970854 30 Left 1200970839 Y:9150797-9150819 CCCCATGATGGACGCCACTTGCC No data
Right 1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200970854 Original CRISPR CAGTGGTGCTAGAGGAATTA AGG Intergenic
No off target data available for this crispr