ID: 1200977111

View in Genome Browser
Species Human (GRCh38)
Location Y:9224827-9224849
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200977111_1200977112 25 Left 1200977111 Y:9224827-9224849 CCAGTAGGACACGATCAAGGAGA No data
Right 1200977112 Y:9224875-9224897 AAGAGAAGAGACAAAGAAACAGG No data
1200977111_1200977113 26 Left 1200977111 Y:9224827-9224849 CCAGTAGGACACGATCAAGGAGA No data
Right 1200977113 Y:9224876-9224898 AGAGAAGAGACAAAGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200977111 Original CRISPR TCTCCTTGATCGTGTCCTAC TGG (reversed) Intergenic
No off target data available for this crispr