ID: 1200977112

View in Genome Browser
Species Human (GRCh38)
Location Y:9224875-9224897
Sequence AAGAGAAGAGACAAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200977111_1200977112 25 Left 1200977111 Y:9224827-9224849 CCAGTAGGACACGATCAAGGAGA No data
Right 1200977112 Y:9224875-9224897 AAGAGAAGAGACAAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200977112 Original CRISPR AAGAGAAGAGACAAAGAAAC AGG Intergenic
No off target data available for this crispr