ID: 1200977113

View in Genome Browser
Species Human (GRCh38)
Location Y:9224876-9224898
Sequence AGAGAAGAGACAAAGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200977111_1200977113 26 Left 1200977111 Y:9224827-9224849 CCAGTAGGACACGATCAAGGAGA No data
Right 1200977113 Y:9224876-9224898 AGAGAAGAGACAAAGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200977113 Original CRISPR AGAGAAGAGACAAAGAAACA GGG Intergenic
No off target data available for this crispr