ID: 1200977278

View in Genome Browser
Species Human (GRCh38)
Location Y:9226788-9226810
Sequence CACTGGGGCTCTCCAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200977278_1200977283 0 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977283 Y:9226811-9226833 ATGGTGTCACAGTTCTGACTTGG No data
1200977278_1200977287 29 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977287 Y:9226840-9226862 TTTAGGTCTGGGCTTCTGTAAGG No data
1200977278_1200977285 17 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977285 Y:9226828-9226850 ACTTGGAACATGTTTAGGTCTGG No data
1200977278_1200977288 30 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977288 Y:9226841-9226863 TTAGGTCTGGGCTTCTGTAAGGG No data
1200977278_1200977284 12 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977284 Y:9226823-9226845 TTCTGACTTGGAACATGTTTAGG No data
1200977278_1200977286 18 Left 1200977278 Y:9226788-9226810 CCAGAAACTGGAGAGCCCCAGTG No data
Right 1200977286 Y:9226829-9226851 CTTGGAACATGTTTAGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200977278 Original CRISPR CACTGGGGCTCTCCAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr