ID: 1200978500

View in Genome Browser
Species Human (GRCh38)
Location Y:9239280-9239302
Sequence CTTACCATTTAAAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200978496_1200978500 27 Left 1200978496 Y:9239230-9239252 CCTACTCACTGAGATGCTCTTAC No data
Right 1200978500 Y:9239280-9239302 CTTACCATTTAAAACTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200978500 Original CRISPR CTTACCATTTAAAACTTGGT GGG Intergenic
No off target data available for this crispr