ID: 1200979229

View in Genome Browser
Species Human (GRCh38)
Location Y:9246830-9246852
Sequence GCATGAAAACAAATGGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200979229_1200979231 -9 Left 1200979229 Y:9246830-9246852 CCTTAGTCCATTTGTTTTCATGC No data
Right 1200979231 Y:9246844-9246866 TTTTCATGCTATTGAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200979229 Original CRISPR GCATGAAAACAAATGGACTA AGG (reversed) Intergenic
No off target data available for this crispr