ID: 1200979390

View in Genome Browser
Species Human (GRCh38)
Location Y:9248143-9248165
Sequence AAGCATACTCAGACCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200979390_1200979391 -2 Left 1200979390 Y:9248143-9248165 CCATGCATGGTCTGAGTATGCTT No data
Right 1200979391 Y:9248164-9248186 TTACCGCAGTCCCTGAGCCTTGG No data
1200979390_1200979396 23 Left 1200979390 Y:9248143-9248165 CCATGCATGGTCTGAGTATGCTT No data
Right 1200979396 Y:9248189-9248211 TCGCTATGTGTCCTAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200979390 Original CRISPR AAGCATACTCAGACCATGCA TGG (reversed) Intergenic
No off target data available for this crispr