ID: 1200980669

View in Genome Browser
Species Human (GRCh38)
Location Y:9260693-9260715
Sequence ATCCCACACCCATTTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200980669_1200980673 -5 Left 1200980669 Y:9260693-9260715 CCAGAACTAAATGGGTGTGGGAT No data
Right 1200980673 Y:9260711-9260733 GGGATGGATTGATGTTTGGTGGG No data
1200980669_1200980671 -9 Left 1200980669 Y:9260693-9260715 CCAGAACTAAATGGGTGTGGGAT No data
Right 1200980671 Y:9260707-9260729 GTGTGGGATGGATTGATGTTTGG No data
1200980669_1200980672 -6 Left 1200980669 Y:9260693-9260715 CCAGAACTAAATGGGTGTGGGAT No data
Right 1200980672 Y:9260710-9260732 TGGGATGGATTGATGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200980669 Original CRISPR ATCCCACACCCATTTAGTTC TGG (reversed) Intergenic
No off target data available for this crispr