ID: 1200982345

View in Genome Browser
Species Human (GRCh38)
Location Y:9273718-9273740
Sequence CCTGCTGGGCAGTGTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200982345_1200982354 3 Left 1200982345 Y:9273718-9273740 CCAGCCCCACACTGCCCAGCAGG No data
Right 1200982354 Y:9273744-9273766 CCCGAGTCCAGCGAAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200982345 Original CRISPR CCTGCTGGGCAGTGTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr