ID: 1200990302

View in Genome Browser
Species Human (GRCh38)
Location Y:9339535-9339557
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 9, 1: 1, 2: 3, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200990296_1200990302 27 Left 1200990296 Y:9339485-9339507 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69
1200990298_1200990302 6 Left 1200990298 Y:9339506-9339528 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907275355 1:53313944-53313966 TCCAGGAAGGGCATGGCAGTGGG + Intronic
907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG + Intronic
909952853 1:81739804-81739826 TCCAGGCTGTTCCAGGCATTAGG + Intronic
915495778 1:156281999-156282021 TCCAGAGCGTTCTTGGGATTTGG - Intronic
918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG + Intergenic
918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG + Intergenic
920377213 1:205515536-205515558 TCTAGGACGCTGATGGCAGTTGG + Intronic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG + Intergenic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1067838046 10:49653699-49653721 TGCAGGACCTGCCTGGCATTTGG + Intronic
1071806901 10:89132300-89132322 TCCAGGATGTGGATGGGATTGGG + Intergenic
1083511542 11:63213424-63213446 TACTGGACCTTCATGGCCTTAGG + Intronic
1083553755 11:63609789-63609811 TCCAGGATGTTTATGACCTTTGG - Intronic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG + Intergenic
1100245851 12:92756191-92756213 TCTAGAAAGTTCATGACATTTGG - Intronic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1122157330 14:99757776-99757798 TCAGGGAGCTTCATGGCATTGGG - Intronic
1130158456 15:81374381-81374403 TCCAGGACTGTCAGGGCATAAGG - Intergenic
1137303504 16:47177672-47177694 TCCAGAATATTCAGGGCATTGGG - Intronic
1137759112 16:50926376-50926398 TCCAATAAGTTCATGGCTTTGGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1151073045 17:71238826-71238848 TCCAGGACATTCATTGCCTGAGG - Intergenic
1156347180 18:36268249-36268271 TGCAGGAAGTTCAGGGCATGTGG + Intronic
1157635825 18:49153438-49153460 TCCAGGAGGATCATGAAATTTGG - Intronic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1164232619 19:23303535-23303557 TAGAGGACGTTCAGGACATTTGG - Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
930557620 2:52919117-52919139 TGCAGGATTTTCATGGCTTTAGG - Intergenic
935419186 2:102849022-102849044 TCCAAGACTTTCCTGACATTTGG - Intergenic
941279548 2:163533125-163533147 GCCAGTACTTTGATGGCATTTGG - Intergenic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
948519692 2:238528027-238528049 GGCAGGAAGTGCATGGCATTAGG + Intergenic
948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG + Intergenic
1173207845 20:41008417-41008439 TCCAGGACGTCCAAGGCTTCAGG - Intergenic
1174520495 20:51126415-51126437 TCCAGGACGTTGCTTGTATTTGG - Intergenic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1179898389 21:44376235-44376257 ACCAGGATGTTCATGGTACTCGG + Intronic
952445087 3:33373390-33373412 TCCAGAATGTTCATAGCTTTGGG - Intronic
953191010 3:40688187-40688209 TCCAGGACTATCCTGGCTTTAGG + Intergenic
954087428 3:48256408-48256430 AACAGGGCGTTCATGGCCTTGGG - Intronic
955656790 3:61252338-61252360 TCCAGCACCCACATGGCATTTGG - Intergenic
956333260 3:68134778-68134800 TCCAGGAGGTTACTGTCATTGGG + Intronic
961809004 3:129510699-129510721 TCCAGGACCTACATGGGACTAGG + Intronic
962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG + Intronic
963624672 3:147656152-147656174 TGCAGGAAGTTCATGGCTTGTGG - Intergenic
964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG + Intergenic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
983290189 4:165792890-165792912 TCCAGGACTTTCATAGCTATAGG - Intergenic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
1001680932 5:173556349-173556371 TCCAGGACGTTCATCTGATGGGG - Intergenic
1005119777 6:22377283-22377305 TCTAGGACTTTCATGTCTTTAGG + Intergenic
1005753999 6:28909423-28909445 TCCTGGAAGGTCATGGAATTGGG - Intronic
1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG + Intergenic
1011986065 6:93447612-93447634 TCCGGGATGTCCATGACATTTGG - Intergenic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015453228 6:133395136-133395158 TCCAGAACCTTCAAGGAATTTGG - Intronic
1021093861 7:16512725-16512747 TCCACGAGGTTTATGGTATTTGG + Intronic
1028563396 7:92200854-92200876 TAAAGGACATTCATGACATTGGG + Intronic
1030141108 7:106304747-106304769 TCCAGGAAGTTCAAGGGGTTGGG - Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1037108766 8:15141386-15141408 TCCAGGACATTCATGTAATATGG - Intronic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG + Intronic
1047783057 8:128125542-128125564 CCCAGGACGTGCCTGGCTTTGGG - Intergenic
1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG + Intergenic
1057083064 9:92187277-92187299 TCAAGGACTTTCCTGGCACTAGG - Intergenic
1059704609 9:116809803-116809825 TCCTGGACTTGCATTGCATTGGG + Intronic
1062038469 9:134393183-134393205 CCCAGGTCGCTCATGGCTTTAGG - Intronic
1188856490 X:35202385-35202407 TCCAGAACATTCCTGGAATTTGG - Intergenic
1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG + Intergenic
1197318003 X:124992220-124992242 TCCAGGACAGTCTTGGCAGTGGG - Intergenic
1199853878 X:151744193-151744215 TCTAGGACTTTCTTGGCATCAGG - Exonic
1200226204 X:154419294-154419316 TCCAGGGCCTGCATGGCACTTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG + Intergenic
1200830798 Y:7687524-7687546 TCCAGAACATTCAGGCCATTGGG - Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201047875 Y:9906124-9906146 TCCAGGACATTAACGGCATTGGG - Intergenic