ID: 1200992957

View in Genome Browser
Species Human (GRCh38)
Location Y:9359800-9359822
Sequence GGAATTTCTACATGTACGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 9, 1: 4, 2: 2, 3: 9, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992957_1200992962 26 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992962 Y:9359849-9359871 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67
1200992957_1200992963 27 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69
1200992957_1200992960 10 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992960 Y:9359833-9359855 GACAGAGAGTGACAGAATCCAGG 0: 10
1: 2
2: 2
3: 37
4: 357
1200992957_1200992961 20 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992961 Y:9359843-9359865 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992957 Original CRISPR GGAATTTCTACATGTACGAA AGG (reversed) Intronic