ID: 1200992959

View in Genome Browser
Species Human (GRCh38)
Location Y:9359821-9359843
Sequence CACTCTCTGTCTTCCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 8, 1: 5, 2: 4, 3: 50, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992959_1200992962 5 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992962 Y:9359849-9359871 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67
1200992959_1200992963 6 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69
1200992959_1200992961 -1 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992961 Y:9359843-9359865 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120
1200992959_1200992965 15 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992965 Y:9359859-9359881 TTCATGGCATTGGGCTGAAAAGG 0: 9
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992959 Original CRISPR CACTCTCTGTCTTCCTCTCA AGG (reversed) Intronic