ID: 1200992960

View in Genome Browser
Species Human (GRCh38)
Location Y:9359833-9359855
Sequence GACAGAGAGTGACAGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 10, 1: 2, 2: 2, 3: 37, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992957_1200992960 10 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992960 Y:9359833-9359855 GACAGAGAGTGACAGAATCCAGG 0: 10
1: 2
2: 2
3: 37
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992960 Original CRISPR GACAGAGAGTGACAGAATCC AGG Intronic