ID: 1200992961

View in Genome Browser
Species Human (GRCh38)
Location Y:9359843-9359865
Sequence GACAGAATCCAGGACGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 9, 1: 2, 2: 2, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992957_1200992961 20 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992961 Y:9359843-9359865 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120
1200992959_1200992961 -1 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992961 Y:9359843-9359865 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992961 Original CRISPR GACAGAATCCAGGACGTTCA TGG Intronic