ID: 1200992962

View in Genome Browser
Species Human (GRCh38)
Location Y:9359849-9359871
Sequence ATCCAGGACGTTCATGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 9, 1: 1, 2: 1, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992959_1200992962 5 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992962 Y:9359849-9359871 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67
1200992957_1200992962 26 Left 1200992957 Y:9359800-9359822 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200992962 Y:9359849-9359871 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992962 Original CRISPR ATCCAGGACGTTCATGGCAT TGG Intronic