ID: 1200992965

View in Genome Browser
Species Human (GRCh38)
Location Y:9359859-9359881
Sequence TTCATGGCATTGGGCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 9, 1: 0, 2: 0, 3: 11, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200992959_1200992965 15 Left 1200992959 Y:9359821-9359843 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200992965 Y:9359859-9359881 TTCATGGCATTGGGCTGAAAAGG 0: 9
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200992965 Original CRISPR TTCATGGCATTGGGCTGAAA AGG Intronic