ID: 1200992965 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:9359859-9359881 |
| Sequence | TTCATGGCATTGGGCTGAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 183 | |||
| Summary | {0: 9, 1: 0, 2: 0, 3: 11, 4: 163} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200992959_1200992965 | 15 | Left | 1200992959 | Y:9359821-9359843 | CCTTGAGAGGAAGACAGAGAGTG | 0: 8 1: 5 2: 4 3: 50 4: 427 |
||
| Right | 1200992965 | Y:9359859-9359881 | TTCATGGCATTGGGCTGAAAAGG | 0: 9 1: 0 2: 0 3: 11 4: 163 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200992965 | Original CRISPR | TTCATGGCATTGGGCTGAAA AGG | Intronic | ||