ID: 1201000790

View in Genome Browser
Species Human (GRCh38)
Location Y:9469006-9469028
Sequence TCCAGGACGTTCATGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201000784_1201000790 25 Left 1201000784 Y:9468958-9468980 CCTTTCGTACATGTAGAAATTCC No data
Right 1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG No data
1201000786_1201000790 4 Left 1201000786 Y:9468979-9469001 CCTTGAGAGGAAGACAGAGTGAC No data
Right 1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201000790 Original CRISPR TCCAGGACGTTCATGGCATT GGG Intronic