ID: 1201001927

View in Genome Browser
Species Human (GRCh38)
Location Y:9479439-9479461
Sequence CGGGATCTGATGGGTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3254
Summary {0: 8, 1: 5, 2: 262, 3: 963, 4: 2016}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201001927 Original CRISPR CGGGATCTGATGGGTTTTTC AGG (reversed) Intronic
Too many off-targets to display for this crispr