ID: 1201003452

View in Genome Browser
Species Human (GRCh38)
Location Y:9489288-9489310
Sequence GGAATTTCTACATGTACGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 9, 1: 4, 2: 2, 3: 9, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201003452_1201003458 27 Left 1201003452 Y:9489288-9489310 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69
1201003452_1201003455 10 Left 1201003452 Y:9489288-9489310 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1201003455 Y:9489321-9489343 GACAGAGAGTGACAGAATCCAGG 0: 10
1: 2
2: 2
3: 37
4: 357
1201003452_1201003457 26 Left 1201003452 Y:9489288-9489310 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1201003457 Y:9489337-9489359 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67
1201003452_1201003456 20 Left 1201003452 Y:9489288-9489310 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1201003456 Y:9489331-9489353 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201003452 Original CRISPR GGAATTTCTACATGTACGAA AGG (reversed) Intronic
906153537 1:43601291-43601313 AGAATATCTACATGCACCAAAGG + Intronic
907092900 1:51745443-51745465 GAAATGTCTTCATGTATGAAGGG + Intronic
907142158 1:52197533-52197555 GGAATTTCAACATTTAAGATTGG + Intronic
913362441 1:117997046-117997068 GGAATTTAAACATGGAGGAATGG + Intronic
916419836 1:164626501-164626523 GGCATTTCTAGCTGTAGGAAAGG + Intronic
916668673 1:166990810-166990832 GGAATTTTACCATGTAAGAATGG - Intronic
922001482 1:221483117-221483139 GGTATTTTTACATATAGGAAAGG - Intergenic
922075432 1:222238921-222238943 GGGACTTCTACATGTAGGTAAGG + Intergenic
1066213586 10:33264389-33264411 GTAATTCGTACATGTACCAAGGG + Intronic
1074938954 10:118216158-118216180 GGAATTTCTACATGGACATGAGG - Intergenic
1079898548 11:26151780-26151802 TGAATCTCTACAAGTACTAATGG - Intergenic
1081522790 11:43899077-43899099 GGAATTTTGACATGTACAAAGGG + Intronic
1083447088 11:62715308-62715330 GGAATTACTACGGGTACCAAGGG - Exonic
1094615693 12:32034317-32034339 TGACTTGCTACATGTAGGAAAGG + Intergenic
1095829752 12:46571646-46571668 GCTATTTCTACATTAACGAAGGG + Intergenic
1097843793 12:64346114-64346136 GGAATATATACATATACAAAGGG + Intronic
1098066200 12:66619810-66619832 GGAAATTCTGCATGTACAGAGGG + Intronic
1103739752 12:123083317-123083339 AGAATTTCTAAATATACAAACGG + Intronic
1108724124 13:53162355-53162377 AGAATTTCTACATGGAAGAACGG - Intergenic
1116591134 14:46774696-46774718 GGAATTTCTATATGCTAGAATGG - Intergenic
1117586179 14:57208357-57208379 GAAATTTCTACATTCAAGAATGG + Exonic
1119157830 14:72427887-72427909 GGAATTTTTACATGAGAGAAAGG + Intronic
1149946859 17:60937592-60937614 GGAATTTCTAAATGTAGGAAGGG - Intronic
1150365682 17:64582000-64582022 TGAATTTCTACATGTATAAAAGG - Intronic
1151637987 17:75365898-75365920 GGTATTTCTACAGGTAGAAATGG - Intronic
1151846912 17:76662897-76662919 GGAATTATTACATGTATTAAAGG + Intergenic
1152353452 17:79795661-79795683 GGAATTTCTACATGGATGCATGG + Intronic
1153379863 18:4426235-4426257 TGATTTTCTACATGCACTAAGGG - Intronic
1155094328 18:22541584-22541606 GGAATTTCTACATGTAAGAAAGG + Intergenic
1155552293 18:26977478-26977500 TGGCTTTCTACATGTATGAAAGG - Intronic
1159478904 18:68960992-68961014 GGAATTTATATATTTACTAAAGG - Intronic
1165370232 19:35400839-35400861 AGAATTTATACATGTAGAAAAGG - Intergenic
928467902 2:31539991-31540013 TGTAATTCTAAATGTACGAAGGG + Intronic
931706077 2:64947485-64947507 AGAATGACTACATGTAGGAATGG + Intergenic
933178467 2:79202992-79203014 AGAAATTCTACATGGAAGAAAGG - Intronic
942364481 2:175209143-175209165 GGAAGTTATACATGTGGGAAGGG - Intergenic
943105088 2:183535780-183535802 GGAAATTCTACATGGACAATCGG + Intergenic
945104193 2:206293561-206293583 GGAATTTCTACAAGTCCATAAGG + Intronic
948270206 2:236668279-236668301 GGAATTTCTACATTTACTGATGG + Intergenic
1169608755 20:7354523-7354545 GGAATATCTACAAGGACAAATGG + Intergenic
1172325079 20:34028344-34028366 GGAATTTCTACAAGGAAGAAGGG + Intronic
1180309443 22:11157709-11157731 TTGATTTCTACATGTGCGAAAGG - Intergenic
1180547920 22:16519520-16519542 TTGATTTCTACATGTGCGAAAGG - Intergenic
1183617146 22:38952854-38952876 AGAATTTCTACACATAGGAAGGG + Intronic
949809127 3:7987204-7987226 GGAATTACTAAATGGACAAAGGG + Intergenic
951549978 3:23867538-23867560 GGTATTTCTACATTAAAGAAGGG + Intronic
954712945 3:52513969-52513991 GGAATTGCTGCAGGTACGGAAGG + Exonic
956247943 3:67205070-67205092 GCAATTTCTTCATTTACTAATGG + Intergenic
956917490 3:73887852-73887874 GGAATTTCTATTTGTTCCAATGG - Intergenic
957434453 3:80155301-80155323 TGAATTTCTAAATGGAAGAAAGG + Intergenic
958503086 3:94939102-94939124 GTAAAATCTACATGTACTAAGGG - Intergenic
959036744 3:101375349-101375371 GGAGTTTCTCCATGTTGGAAAGG - Intronic
969321240 4:6414280-6414302 TTACTTCCTACATGTACGAAAGG + Intronic
970743722 4:19268880-19268902 CGAATTTCTACATGTTCCAGTGG - Intergenic
972588313 4:40459663-40459685 GGTATTTCTGCATGGCCGAAAGG + Intronic
972738905 4:41872666-41872688 GGAATTTCTACATGAACTCAAGG + Intergenic
974509459 4:62819023-62819045 GAAATTTCTACATTCAAGAATGG - Intergenic
975444261 4:74444696-74444718 GGAATTGCTTCATGTAGGATGGG - Intergenic
975594320 4:76033486-76033508 GGATTTTCTCCAAGTAAGAAGGG + Intronic
983821953 4:172205737-172205759 GGAACTTCTGCATGTAAGAATGG - Intronic
984851148 4:184153558-184153580 GGAAGGTCTACATGTACTACTGG - Exonic
985139377 4:186823031-186823053 GTAATTTCTATATGTTCTAATGG - Intergenic
991396551 5:66210002-66210024 GGAATTTGCACTTGTATGAATGG - Intergenic
993789348 5:92188500-92188522 TGCATTTCTACAAGTATGAATGG + Intergenic
994506831 5:100653763-100653785 TAAATTTCGACATGTAAGAATGG + Intergenic
996398866 5:123037943-123037965 GGAATTTCTAAATGTCAGATGGG + Intergenic
1000255279 5:159532108-159532130 GGAATTTCAACATGGGAGAAAGG - Intergenic
1000484389 5:161822108-161822130 GGAATATCTATATATATGAAAGG - Intergenic
1004554334 6:16680907-16680929 GGAATTATTACATCTACGAGAGG + Intronic
1005636788 6:27760442-27760464 TGAATTTCTACATGAAATAAAGG + Intergenic
1006720916 6:36150231-36150253 GGAGTTTGTACATGAACTAAAGG - Intergenic
1007431418 6:41779613-41779635 GGAATTTCTACATGCCCGTAAGG + Intronic
1016541833 6:145174556-145174578 GGAATTTCTCCATGTAGGTCAGG + Intergenic
1024545780 7:50516824-50516846 GGAATTTCTCCATGTCTTAAGGG - Intronic
1038402595 8:27296799-27296821 GGAATTTCAACATGTATTTATGG + Intronic
1041033474 8:53762328-53762350 GGAAATCCTACATGAATGAAGGG + Intronic
1053373261 9:37580475-37580497 GGAATTCCCAAATGTAGGAAGGG - Intronic
1055941051 9:81650151-81650173 TGAATTTCTAATTTTACGAATGG - Intronic
1060289514 9:122287721-122287743 GGAATTTCAACTTGAACAAATGG - Intronic
1192469703 X:71387449-71387471 AGACTTTCTACAGGTAAGAATGG + Exonic
1192973003 X:76253381-76253403 GGAACTTCTCCATCTACCAAGGG - Intergenic
1198759671 X:140018244-140018266 GGCGTTTCTACATGTACTTAGGG + Intergenic
1198779115 X:140215806-140215828 GGCGTTTCTACATGTACTTAGGG - Intergenic
1198997746 X:142594301-142594323 GGTATTTCTACAAGTATAAATGG - Intergenic
1199587574 X:149432330-149432352 GCAATTTCTACTGGTACCAAGGG - Intergenic
1199733783 X:150664896-150664918 AGAATTTCTCCAAGTACAAATGG - Intronic
1200684766 Y:6248220-6248242 GGAATTTCTACATGTACGAAAGG - Intronic
1200687393 Y:6268536-6268558 GGAATTTCTACATGTATGAAAGG - Intergenic
1200830804 Y:7687574-7687596 GGAATTTCTACTTGTATGAAGGG + Intergenic
1200990296 Y:9339485-9339507 GGAATTTCTACATGTACGAAAGG - Intronic
1200992957 Y:9359800-9359822 GGAATTTCTACATGTACGAAAGG - Intronic
1200995611 Y:9380078-9380100 GGAATTTCTACATGTACGAAAGG - Intronic
1200998276 Y:9400424-9400446 GGAATTTCTACATGTACGAAAGG - Intronic
1201000784 Y:9468958-9468980 GGAATTTCTACATGTACGAAAGG - Intronic
1201003452 Y:9489288-9489310 GGAATTTCTACATGTACGAAAGG - Intronic
1201006108 Y:9509570-9509592 GGAATTTCTACATGTACGAAAGG - Intergenic
1201008766 Y:9529883-9529905 GGAATTTCTACATGTACGAAAGG - Intronic
1201011342 Y:9550052-9550074 GGAATTTCTACATGTATGAAAGG - Intergenic
1201047880 Y:9906174-9906196 GGAATTTCTACATGTATGAAAGG + Intergenic
1201677342 Y:16601479-16601501 GGAATGTCTTCAAGTACAAATGG - Intergenic