ID: 1201003454

View in Genome Browser
Species Human (GRCh38)
Location Y:9489309-9489331
Sequence CACTCTCTGTCTTCCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 8, 1: 5, 2: 4, 3: 50, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201003454_1201003460 15 Left 1201003454 Y:9489309-9489331 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1201003460 Y:9489347-9489369 TTCATGGCATTGGGCTGAAAAGG 0: 9
1: 0
2: 0
3: 11
4: 163
1201003454_1201003456 -1 Left 1201003454 Y:9489309-9489331 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1201003456 Y:9489331-9489353 GACAGAATCCAGGACGTTCATGG 0: 9
1: 2
2: 2
3: 10
4: 120
1201003454_1201003457 5 Left 1201003454 Y:9489309-9489331 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1201003457 Y:9489337-9489359 ATCCAGGACGTTCATGGCATTGG 0: 9
1: 1
2: 1
3: 8
4: 67
1201003454_1201003458 6 Left 1201003454 Y:9489309-9489331 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201003454 Original CRISPR CACTCTCTGTCTTCCTCTCA AGG (reversed) Intronic
900303366 1:1989156-1989178 GACTCTCTCTCTCTCTCTCAAGG - Intronic
900936286 1:5768273-5768295 CAATCTCTGCCTTCTTCACATGG + Intergenic
901687640 1:10952401-10952423 TACTCTGTATCTTCCTATCAAGG + Intronic
904435476 1:30492138-30492160 CTCTCTCTCTCTACCTGTCAAGG - Intergenic
904559017 1:31384455-31384477 ATCTCTCTGTCCTCTTCTCAGGG + Intergenic
904624637 1:31795528-31795550 TCCTCTCTCTCTTCCTCTCTGGG + Intronic
906842640 1:49156648-49156670 CACTCTCTTTTTTCCTCTCTGGG - Intronic
906901896 1:49844517-49844539 CCCTCTCTCTCTTCCTTTCCTGG + Intronic
907240029 1:53076135-53076157 CACTCTCTGTCCTCACCTCCTGG - Intronic
907286939 1:53386735-53386757 CACTCTGTTTCTTCAACTCAGGG - Intergenic
907537601 1:55179239-55179261 CACTCTCTGTTCTCCTCCCATGG + Intronic
907965289 1:59323001-59323023 CTCTCTCTGCCTTCTTCTCCGGG - Intronic
908447613 1:64215820-64215842 CTCTCTCTCTCTTTCTCTCCAGG + Intronic
908582790 1:65534636-65534658 CATTCTCTTTCTCCCTCTCTCGG - Intronic
909093581 1:71258081-71258103 CTCTCCCTGTTTTCCTATCAGGG - Intergenic
910169980 1:84367403-84367425 CCTTCTCTGTCTTTCTCTCTTGG + Intronic
910863864 1:91769462-91769484 CACTCTCTTTCTTCCCCACCTGG + Intronic
911202668 1:95061477-95061499 CTCTCTCTCTCTCTCTCTCAAGG - Intronic
911835383 1:102612292-102612314 CACTCTGTGTCTTTTACTCAGGG - Intergenic
912183846 1:107250758-107250780 CCCTATCTCTCTTCCTCTCCAGG - Intronic
912642113 1:111356815-111356837 CCCTATCTCTCTTCCTCTCCTGG - Intergenic
912648333 1:111415996-111416018 CTCTCTTTCTCTTACTCTCATGG - Intronic
912856215 1:113170803-113170825 AGCTCTCTGTTTTCGTCTCAGGG - Intergenic
913490856 1:119378495-119378517 CCTTCTCTGTCTTCTTCACAGGG + Intronic
914799712 1:150951665-150951687 CATTCTATGTCTTCATTTCAAGG - Intronic
914971466 1:152310867-152310889 CACACAGAGTCTTCCTCTCATGG - Exonic
915555739 1:156659833-156659855 CAACCTCTGCCTTCCTCTCTGGG - Intergenic
917089766 1:171341392-171341414 CTCCCTCTTTTTTCCTCTCAGGG + Exonic
917177220 1:172249253-172249275 GACTCTCTGGTTTCCTTTCAAGG + Intronic
918423806 1:184387974-184387996 CACCCTCTGGCTGCCTCGCATGG - Intronic
919478760 1:198061014-198061036 CTCTCTCTCTCTTTCTCTCCTGG - Intergenic
919560260 1:199109575-199109597 CAATCTGAGTCTTCTTCTCAAGG - Intergenic
919637199 1:200014401-200014423 CTCTCTCTGTCTTACTCTGCAGG - Intergenic
920210862 1:204327332-204327354 TCCTTTCTGTCTCCCTCTCAAGG + Intronic
920673941 1:208025861-208025883 GCCTCTCTTTCTGCCTCTCACGG - Exonic
921849695 1:219921945-219921967 CTCTCTCTGTCTCTCTCTCTCGG - Intronic
922487650 1:225988051-225988073 TACTCTCTGCCTTCTTCTCCTGG + Exonic
922613173 1:226944689-226944711 CTCTCTCTCTCTCTCTCTCAGGG - Intronic
923033680 1:230269087-230269109 CACTCTCTGTCCCCCTCCAATGG + Intronic
923134641 1:231107315-231107337 CACACTCTGCCTTCATCCCAGGG + Intergenic
924077257 1:240353075-240353097 CATTCTCTGTGTTGATCTCAAGG - Intronic
924144536 1:241060483-241060505 CACTCCCAGTTTTCCTCTTAAGG + Intronic
924358679 1:243212692-243212714 CTCTCTCTCTCTTTCTTTCAGGG + Intronic
1063282759 10:4648692-4648714 CACTCTCTGTCTCGCTCTTTTGG - Intergenic
1063292399 10:4762748-4762770 CTCTCTCTCTCTTCCTCCCATGG - Intergenic
1064524385 10:16238857-16238879 AACTCTATCTCTTCCTATCAAGG - Intergenic
1064898086 10:20262047-20262069 CTCTCACTGGTTTCCTCTCAAGG + Intronic
1065553642 10:26893054-26893076 CACTCTCTGTTTGTCTCTCTGGG + Intergenic
1065599520 10:27354567-27354589 CACTCTCTGTTTGTCTCTCTGGG - Intergenic
1066393115 10:34994849-34994871 CAATCTCTGTCTCCCTCTGGTGG - Intergenic
1067460064 10:46451612-46451634 CTCTCTCTGTCTCTCTCTCATGG + Intergenic
1067627126 10:47933001-47933023 CTCTCTCTGTCTCTCTCTCATGG - Intergenic
1067655698 10:48189717-48189739 CATTCCTTCTCTTCCTCTCACGG + Intronic
1067997412 10:51289666-51289688 CTCTCTCTCTCTCTCTCTCATGG - Intronic
1068112238 10:52693289-52693311 CTCTCTCTCTCTCTCTCTCAAGG + Intergenic
1068708611 10:60106005-60106027 TTCTCTCTCTTTTCCTCTCATGG + Exonic
1070169226 10:73920178-73920200 CAGTTTCTGCCTTCCCCTCAGGG + Intronic
1070522793 10:77269093-77269115 CACTCCTTGTCTTCATTTCAGGG + Intronic
1070553103 10:77506706-77506728 CACTCTCTCTCTCTCTCTCTCGG - Intronic
1070934280 10:80281336-80281358 CAGACTCTGTGTACCTCTCAGGG - Intronic
1072310252 10:94147418-94147440 CTCTCTCTTTCTTTCTTTCAAGG - Intronic
1073189273 10:101639182-101639204 CAGTCTCTCTCTGCCCCTCAGGG + Intronic
1073322119 10:102621707-102621729 CCCTCCCTTTCCTCCTCTCAGGG - Intronic
1073550526 10:104396366-104396388 CTCTCTCTCTCTCTCTCTCATGG - Intronic
1075311990 10:121422011-121422033 CACTCTGTTTCTTCCCCTCTAGG - Intergenic
1075313656 10:121434765-121434787 CGCTCTTGGTCTTCCTCTCCTGG + Intergenic
1075608433 10:123832945-123832967 AACTCTGTGTCCTCCTCCCATGG - Intronic
1075623862 10:123947907-123947929 CTCTCTCTGTGTTACTTTCATGG - Intergenic
1075955060 10:126516491-126516513 CCCTCATTGTCTTCATCTCATGG - Intronic
1076211247 10:128646721-128646743 CACTATCTGTCCTCCTCTGAAGG - Intergenic
1076298128 10:129403244-129403266 TACCTGCTGTCTTCCTCTCATGG - Intergenic
1076555080 10:131316253-131316275 CACTCACTGTTTTCCTTCCAGGG + Intergenic
1077134559 11:991989-992011 CCCTCTCTGGCTCACTCTCACGG - Intronic
1078818878 11:14855691-14855713 CTCTCTCTGTCTGTCTCTCTTGG - Intronic
1079710680 11:23679736-23679758 CGCTCTAGGGCTTCCTCTCAGGG - Intergenic
1080149477 11:29033113-29033135 CAATCTCTGCCTTCATCTTATGG + Intergenic
1080737740 11:35033399-35033421 AAACATCTGTCTTCCTCTCAAGG + Intergenic
1081569934 11:44283905-44283927 CTCTCTCTCTCTCCCTCCCATGG + Intronic
1082778749 11:57269757-57269779 CAGCCTCTGTCTGCCTTTCAGGG + Intergenic
1083320968 11:61846424-61846446 CTCTCTCTCTCTCTCTCTCATGG + Intronic
1084039436 11:66532801-66532823 CACACTCTGCCTTCCTCTCCTGG - Exonic
1084899129 11:72296601-72296623 CACTCTATTGCTTGCTCTCAAGG - Intronic
1085485709 11:76861136-76861158 CGCTCTTTGCCTTCCTCACACGG - Intronic
1085591183 11:77762505-77762527 CACTCACTGTCATTTTCTCAAGG + Intronic
1087084541 11:94203203-94203225 GACACTCTGGCTTCCTCACAGGG - Intergenic
1088988084 11:114927500-114927522 CTCCCTCTTTCTTGCTCTCAAGG - Intergenic
1089099252 11:115947194-115947216 CTCTCTCTTTCTTTCTTTCATGG - Intergenic
1089131247 11:116213933-116213955 CACTTTCTGTTTTCCTCTTAAGG - Intergenic
1089170044 11:116505471-116505493 CTCTCTCTCTCTCCCTTTCAAGG + Intergenic
1090414806 11:126533670-126533692 CACTATCTGCCTTCATCCCAAGG - Intronic
1091148326 11:133300770-133300792 CACGCTCTGCCTCCCTCTTAAGG - Intronic
1092412022 12:8260876-8260898 CTCTCTCTCTCTCTCTCTCACGG - Intergenic
1093876651 12:24356445-24356467 CTCTCTCTCTCTTTCTCTCTTGG + Intergenic
1094819240 12:34211668-34211690 CAGTCCCTGGCTTCCTCCCAGGG - Intergenic
1095177458 12:39109913-39109935 CGCTCTCTGCCTTCCTAACACGG + Intergenic
1095678135 12:44943819-44943841 CACTCTCTGCCTTACTCAAATGG - Intergenic
1095926851 12:47587019-47587041 CCTTCTCTGACTTCCTCCCATGG + Intergenic
1096512816 12:52141099-52141121 CTCACTCTGTCTTCTTCTGATGG + Intergenic
1096839843 12:54373567-54373589 CACTCTCTGTCTTCCCCGAGGGG + Intronic
1097791688 12:63821958-63821980 CATTCGCTCTCCTCCTCTCACGG + Intergenic
1097988896 12:65813575-65813597 CACTCTTTTTCTGCCTTTCATGG - Intergenic
1098075200 12:66722352-66722374 CCCTGTCTGTCTCCCTCTCCTGG - Intronic
1098471654 12:70852057-70852079 CACTGTCTGCCTTCCTTCCAGGG - Intronic
1098550294 12:71754880-71754902 CCCTCTCTGCCTCCCTCTAATGG - Exonic
1098611274 12:72461391-72461413 CATTCTTTTTCTTCCTTTCAAGG - Intronic
1100218961 12:92483137-92483159 CTCTCTGTGTCTTCTTCGCATGG - Intergenic
1100229844 12:92595770-92595792 AAATCTCTGTCTGTCTCTCATGG + Intergenic
1100728462 12:97436048-97436070 CTCTCTCTCTCTTTTTCTCAAGG + Intergenic
1101724448 12:107377385-107377407 CTCTCTCTCTCTCTCTCTCAAGG - Intronic
1104047929 12:125176370-125176392 TACCCTCTGTCTTCCTTTCATGG - Intergenic
1104099314 12:125591390-125591412 CTCTCTCTCTCTTCCCCACATGG + Intronic
1104142964 12:126006118-126006140 CAGTCTCTGTGTTCCCCTGAGGG + Intergenic
1104927723 12:132322277-132322299 CACTCCCCGTCTTCCTCCCTGGG + Intronic
1106521914 13:30505832-30505854 CACTCACTCCCATCCTCTCAGGG + Intronic
1106637904 13:31550753-31550775 CACTCTCTTTCTTCCTTGCATGG + Intergenic
1107612321 13:42127920-42127942 CTCTCTCTCTCTCTCTCTCATGG - Intronic
1108449704 13:50548918-50548940 CACACTCTGCCTTCTACTCAGGG - Intronic
1109700814 13:66022511-66022533 CCCTATCTGTCTTCCTCTCCTGG + Intergenic
1109988675 13:70024348-70024370 CACTCTCTATCTTTCTATCTAGG - Intronic
1110147840 13:72214446-72214468 CAATCTCTGTCTTTTTCTCCTGG + Intergenic
1110413619 13:75229092-75229114 CTCTCTCTCTCTTTCTCTCAAGG + Intergenic
1110847134 13:80202763-80202785 CTCTCTGTGTCTTTCTTTCATGG + Intergenic
1111264172 13:85785286-85785308 CACTCACTGTCTGCCTTTGAAGG - Intergenic
1111359045 13:87149879-87149901 CTCTCTCTCTCTCTCTCTCAGGG - Intergenic
1111795190 13:92910494-92910516 CTCCCTCAGTCTTCCTCTGAGGG - Intergenic
1112590524 13:100760044-100760066 CTCTCTCTCTCTCTCTCTCAGGG + Intergenic
1112633028 13:101182236-101182258 CTCTCTCTGTCCTGCTCTGAGGG - Intronic
1113862397 13:113496032-113496054 CTCTCTCTCTCTCCCTCTCTAGG - Intronic
1113898831 13:113784493-113784515 CTCTCTCTGTCTTCCTCACGTGG - Intronic
1114338827 14:21721737-21721759 CAGTCTCTGTTTTCCTCTTCAGG + Intergenic
1115987385 14:39115907-39115929 TACTCTCTGTCTTCCTCAGGAGG - Intronic
1116139532 14:40973522-40973544 CTCTCTCTGTCTCTCTCTCCAGG + Intergenic
1118632747 14:67721240-67721262 CTCGCTCTGTGTTCCTCTCTTGG - Intronic
1119251849 14:73162464-73162486 CTCTCTCTCTCTCCTTCTCATGG - Intronic
1119443528 14:74645808-74645830 CACCCCCTTACTTCCTCTCAAGG + Intergenic
1119517581 14:75260278-75260300 CAGTCTCTCTCTTTCTCTCTGGG - Intronic
1119521708 14:75291075-75291097 CACTCCTTGTAATCCTCTCACGG + Intergenic
1119563518 14:75609418-75609440 CTCTCTCTTTCTCTCTCTCAGGG + Intronic
1119666006 14:76485623-76485645 CTCTCTCTCTCTCTCTCTCAGGG - Intronic
1119894262 14:78206543-78206565 CACTCTTTTTTTTCCTCTCTTGG - Intergenic
1120405380 14:84088419-84088441 CACACTCTCTCTCTCTCTCATGG - Intergenic
1120990358 14:90370939-90370961 CTCTCTCTGTCTCTCTCTCTCGG - Intergenic
1121524433 14:94609580-94609602 CACTCTCTTTGTCTCTCTCATGG + Intronic
1125222605 15:37356692-37356714 AACTGTCTGTCTTTCTCCCAGGG + Intergenic
1125890023 15:43258851-43258873 CTCTCTCTCTCTCTCTCTCAGGG - Intronic
1126221885 15:46223617-46223639 AACTCGCTGGCTTACTCTCAAGG + Intergenic
1126897536 15:53275063-53275085 CTCTGTCTCTCTTCCTCTCCCGG + Intergenic
1128380173 15:67106566-67106588 CACTGTCTGTCTTCCTCTTGAGG + Intronic
1128398171 15:67250488-67250510 CACTTTCTACATTCCTCTCAAGG + Intronic
1129483489 15:75845395-75845417 CACTTTCTGTTTTCCACTCTTGG - Intronic
1129940760 15:79494979-79495001 CTCTCTCTTTCTTCCTGCCAAGG - Intergenic
1130161621 15:81407414-81407436 CACTTTCTGTTTTCAGCTCAGGG - Intergenic
1130370487 15:83282875-83282897 CACTCTCTCTCTCCCTGACAGGG + Intronic
1131329588 15:91484755-91484777 GTCTCTCTGTCTCTCTCTCAAGG - Intergenic
1131989847 15:98082682-98082704 CACTTTCTGTCCTCCTCTTCTGG + Intergenic
1133519738 16:6545391-6545413 CCCTCTCTCTCTTTCTCTCCAGG + Intronic
1134096833 16:11423939-11423961 CACCCTCTGCCTTCCTCTCCAGG + Intronic
1134668755 16:16038922-16038944 CAAACTCTGTCCTCCTCCCAAGG - Intronic
1134743119 16:16565882-16565904 TTCTCTCTCTCTCCCTCTCAGGG - Intergenic
1134924441 16:18146578-18146600 TTCTCTCTCTCTCCCTCTCAGGG + Intergenic
1135048648 16:19174406-19174428 CGCTGTCTGTCTCCCTCTCTGGG - Intronic
1135635799 16:24074304-24074326 CCCTCTCTGTCTTCCTCCCAAGG - Intronic
1136087911 16:27898702-27898724 CTCTCTCTCTCTTTCTCTCTGGG + Intronic
1136142250 16:28294939-28294961 CACTCTCTGTCATTTTCTCTGGG - Intronic
1138179914 16:54933944-54933966 CTCTCTCTGTCTCTCTCTCTCGG - Exonic
1138238978 16:55411297-55411319 CACTTTCTCTCTGCCTCTGATGG - Intronic
1138316048 16:56071284-56071306 CTCTCTCTGTCTCTCTCTCTCGG - Intergenic
1138573079 16:57888473-57888495 CTCTCTCTCTCTTTCTCACAGGG + Intronic
1139367209 16:66440819-66440841 AATTCTTTGTCTTCCTCTCTAGG + Intronic
1139528328 16:67529615-67529637 CACCCTTTGTCCTCCTCTCCAGG + Exonic
1140068001 16:71626451-71626473 CCCTCTCTCTCTCCCTCTCCCGG - Exonic
1140087354 16:71808936-71808958 CGCTCCCTGTCCTCCTCTCCTGG + Exonic
1140724404 16:77799185-77799207 CTCTCCCTCTCTTCCTCTCCCGG + Intronic
1141090916 16:81129760-81129782 CTCTCTCTCTCTTTCTTTCATGG + Intergenic
1141417298 16:83885812-83885834 CTCTCTCTCTCTCTCTCTCAGGG + Intergenic
1143117863 17:4590795-4590817 CACTCTCTGGCATCTTCTGAAGG + Intronic
1143268996 17:5661825-5661847 CTCTCTCTCTCTCCGTCTCAGGG - Intergenic
1144029361 17:11305724-11305746 CACTCTCTGTCATGCCCTGAGGG - Intronic
1144301713 17:13927573-13927595 TATCCTCAGTCTTCCTCTCATGG + Intergenic
1144330293 17:14217155-14217177 AATTATCTGTCTTCTTCTCAAGG - Intergenic
1145775619 17:27526100-27526122 CTCTCTCTCTCTCTCTCTCATGG + Intronic
1146723318 17:35138446-35138468 CTCTCTCTCTCTTTCTTTCATGG + Intronic
1148288001 17:46413442-46413464 GGCTCCCTGTCTTCCTCTCTGGG + Intergenic
1148310171 17:46631022-46631044 GGCTCCCTGTCTTCCTCTCTGGG + Intronic
1148326484 17:46786188-46786210 CACTCTCTTTCCTCCTCCCCAGG - Intronic
1148857081 17:50584682-50584704 CACTGTCTCTCTTCCTCTCCTGG - Intronic
1149535506 17:57430662-57430684 GTCTGTCTGTCTTCTTCTCAAGG + Intronic
1150897031 17:69223879-69223901 CACTTTCTGTCTTAGTCTCACGG - Intronic
1153641312 18:7159848-7159870 AAATCTCTGTCTACCTCTCTGGG - Intergenic
1155038486 18:22045186-22045208 CTCTTTCTCTCTCCCTCTCAAGG - Intergenic
1156023047 18:32621269-32621291 CATTCTCTTCCTTCCTTTCAGGG + Intergenic
1157993534 18:52526871-52526893 CTCTCTCTGTATTAATCTCATGG + Intronic
1158007656 18:52691556-52691578 CAATCTCTGGCTTAATCTCAGGG + Intronic
1158155732 18:54423432-54423454 CTCTCTCTGTGTTTCTCTCTGGG - Intergenic
1158300786 18:56050103-56050125 CACTCTTTGTGTTCCTCTTGAGG - Intergenic
1158604471 18:58883096-58883118 CCCTCTGAGTCTTCCTCACAAGG - Intronic
1158907596 18:62029091-62029113 ATCTCTTTGTCTTCCTCCCATGG + Intergenic
1159894117 18:73980509-73980531 CTCTCTCTGTCTCCCTCTGCTGG + Intergenic
1161570343 19:5027068-5027090 CTTTCTCTGTCTCCCGCTCACGG - Intronic
1162362486 19:10228394-10228416 CACCCCCAGTCTTCCTCTCAGGG - Intronic
1163071225 19:14843644-14843666 CACTCTCAGCCTTTCTCTGAGGG + Intergenic
1163173299 19:15547965-15547987 CTCTCTCTCTCTCTCTCTCAGGG - Intronic
1163267385 19:16229154-16229176 CAGCCTCTGTCTTCACCTCAGGG + Intronic
1163396718 19:17067777-17067799 CACTGCCTGTCTTCCACTCTGGG - Intronic
1164404855 19:27935781-27935803 CCCTCTGTGTCTTCCTTCCATGG - Intergenic
1164447666 19:28331684-28331706 CAGGCACAGTCTTCCTCTCAGGG + Intergenic
1164780624 19:30888804-30888826 AACCCTATGTCTTCCTCACAAGG + Intergenic
1166138220 19:40790324-40790346 GACTCTCTGTCTTCCAGTCTTGG + Intronic
1166608945 19:44171663-44171685 CTCTCTCTGTCCTCCTGTCTTGG - Intronic
1166917290 19:46204161-46204183 CACTGGCTGTCCTCCTTTCATGG - Intergenic
1167730103 19:51247779-51247801 CTCCCTCCGTCTGCCTCTCAGGG - Intronic
1167769143 19:51503012-51503034 CAATTTCTTTCTTCATCTCATGG - Intergenic
1167834918 19:52060624-52060646 CACTCTCTGGTATCCTCTGAAGG + Intronic
1168059075 19:53881341-53881363 CCGTCTCTGTCTTCCTCTCTGGG - Intronic
1168327434 19:55545462-55545484 CTCTCTCTGTCTTCCTCCCCTGG + Intronic
925298833 2:2795640-2795662 CACTCCCTCTTTTCCTCTCGAGG + Intergenic
925564610 2:5236472-5236494 CTTTCTCTTTCTCCCTCTCAAGG - Intergenic
926833264 2:16988555-16988577 CTCTCTCTGTCCTCCTCCCCTGG + Intergenic
927102539 2:19799174-19799196 ATCTCTCTCTCTTCCTCTGAAGG + Intergenic
927237548 2:20888490-20888512 TACTCTCTGTCTCTCTCTCCTGG + Intergenic
927328951 2:21840281-21840303 CACACTCTGTGCTCCTTTCAAGG + Intergenic
927569102 2:24142320-24142342 CCCTCTCTATCTTCCTTTCCTGG + Intronic
927893257 2:26765442-26765464 CTCTCTCTGTCTCCATCTCAGGG + Intronic
927981001 2:27375166-27375188 TCCTCTCTGTCTTCCTCTAAGGG + Intronic
931418792 2:62106345-62106367 CATTCTCTGTGTTCTACTCAGGG + Intronic
931456350 2:62412445-62412467 CTCTCTCTGTCGTCTACTCATGG + Intergenic
932081997 2:68723870-68723892 CTCTCTCTCTCTTTCTCTCTCGG + Intronic
932376876 2:71244256-71244278 CACTCTCTGTGTGCCCTTCAAGG - Intergenic
932399495 2:71470141-71470163 CCCTCTCTCTCATCCTGTCAGGG + Intronic
932636373 2:73391888-73391910 CTATCTCTGTATTCCTTTCAGGG + Intronic
933636354 2:84712815-84712837 CAGTTTCTCTCTTCTTCTCATGG + Intronic
934605206 2:95689882-95689904 CACCCTCTGCCATCCTCCCATGG + Intergenic
935573488 2:104686930-104686952 CACTCCCTGTGTTCTTGTCAAGG - Intergenic
935592234 2:104854184-104854206 CTCTCTCTCTCTCCCTCTCTCGG - Intergenic
937123416 2:119456815-119456837 CTCTCTCTGTGTGTCTCTCATGG - Intronic
937410246 2:121668587-121668609 CTCTCTCTCTCTTTCTGTCATGG - Intergenic
937501542 2:122484488-122484510 CTCTCTCTCTCTCTCTCTCAAGG + Intergenic
937786163 2:125901168-125901190 CAGTTTCTGTCTTGCTCTCATGG - Intergenic
940752825 2:157646433-157646455 CGCTCTCTGCCTTCCTGCCAGGG + Intergenic
941775357 2:169387417-169387439 CCCACTCTTTCTTCCTGTCAAGG + Intergenic
942307512 2:174623507-174623529 CACTCTCTTGCTCACTCTCAGGG - Intronic
942449109 2:176098306-176098328 CACTCGCTCTCGTCCTCTCTTGG - Intergenic
943411553 2:187555887-187555909 CCCTCTCCCTCTCCCTCTCACGG + Intronic
944404305 2:199364904-199364926 CACTATCAGTTTTACTCTCATGG - Intronic
944922603 2:204431093-204431115 CTCTCTCTTTCTTTCTTTCATGG + Intergenic
945421276 2:209639897-209639919 TACTCTATGTCTCCCTCACAAGG - Intronic
945957214 2:216097711-216097733 CACTATCTGTCTTTCCCTGAAGG - Intronic
946066255 2:216989888-216989910 CACTCTCTCCTTTCCTCCCATGG - Intergenic
946388911 2:219403971-219403993 CACTTACCGTCTCCCTCTCACGG - Intergenic
948493527 2:238330080-238330102 CACTCTCAGTATTGCTCTGAAGG + Intronic
1168741975 20:199895-199917 CACTCCCTGGCTACTTCTCAAGG + Intergenic
1168889668 20:1286699-1286721 CACACTCTCTCTTGCTCTCCTGG - Intronic
1169711563 20:8570330-8570352 CACTCTCTACCTTCCTCACTGGG - Intronic
1170051345 20:12149088-12149110 CAATCTCTGCCTTCTTCACATGG + Intergenic
1170316937 20:15052629-15052651 CCCTGTCTGTCTCCCTCTCCTGG + Intronic
1170712045 20:18800029-18800051 CACCATATGTATTCCTCTCATGG + Intergenic
1171310992 20:24144372-24144394 GCCTCTCTGTCTTTCTATCAGGG + Intergenic
1172119803 20:32591505-32591527 CTCTCTCTCTCTCTCTCTCAGGG - Intronic
1172479030 20:35260208-35260230 CTCCCTCTGTCTCCCCCTCAGGG + Intronic
1172778370 20:37421269-37421291 CCCTCTCTCTGTTCCTCTCAGGG + Intergenic
1172928757 20:38566233-38566255 CCCTCCCTGTCTTACTCTCTGGG + Intronic
1172977000 20:38913680-38913702 CAGCCTCTGTCTTCCTCCCTAGG - Intronic
1173762538 20:45576424-45576446 CTCTCACTGTCTTTCTCCCAGGG + Intronic
1173925134 20:46775401-46775423 TTCTCTCAGTCTTCCTCTCTGGG + Intergenic
1174864591 20:54123548-54123570 CACTCCCTCTCTTCCCCTGAAGG - Intergenic
1175433676 20:58927278-58927300 CATTCTGTGTCTTCCTCACCCGG + Intergenic
1175756387 20:61533079-61533101 CACTCTCAGGGTCCCTCTCAGGG - Intronic
1176788461 21:13289125-13289147 CACTCTTGCCCTTCCTCTCATGG + Intergenic
1177114952 21:17074012-17074034 CTCTCTCTTTCTTCTTCTCTTGG + Intergenic
1177321635 21:19529199-19529221 CAGTCTCTGTCTTGCTTTCAGGG - Intergenic
1177617665 21:23544807-23544829 CTGTCTCTATCTTTCTCTCAAGG - Intergenic
1177973511 21:27819646-27819668 CTCTCTCTCTCTTCCTCACTAGG + Intergenic
1179593330 21:42425987-42426009 CTCTCTCTCTCTTTCTCTCTCGG - Intronic
1180743268 22:18068490-18068512 CTCTCTCTCTCTGTCTCTCAAGG + Intergenic
1182066572 22:27435519-27435541 CTCTCTCTGTCTCTTTCTCAGGG + Intergenic
1182309778 22:29396349-29396371 CACTCTCTCTCTTTCTGCCATGG + Intronic
1182916170 22:34034215-34034237 CTCTCTCTTTCTTCTGCTCATGG + Intergenic
1183041093 22:35178545-35178567 GACTCCCTGTCTTCCTCATAGGG + Intergenic
1183467402 22:37986630-37986652 CAGACACTGCCTTCCTCTCAGGG + Intronic
1183468940 22:37995564-37995586 CATTGTCTGTCTTCCCCACAAGG + Intronic
1185017252 22:48351990-48352012 CCATCTCTGCCTCCCTCTCATGG - Intergenic
950013037 3:9736849-9736871 CACCCTCTCTCTCCCCCTCAAGG - Intronic
951445650 3:22776947-22776969 CACTCTCAGTGATCCTCTCCCGG - Intergenic
952256937 3:31703953-31703975 CTCTCTGGCTCTTCCTCTCAGGG - Intronic
952590903 3:34952770-34952792 CACTCTCAGGCCTCCTCTGACGG - Intergenic
952731002 3:36636438-36636460 CACTCCCTTTCTTCCTCTTTAGG + Intergenic
953381153 3:42473767-42473789 CAGCTTCCGTCTTCCTCTCAGGG - Intergenic
953443043 3:42936290-42936312 CACTCTCTGGATTTCTCTCTAGG - Intronic
954119279 3:48485968-48485990 CAGTCTCTCCCTTCCTCTTAAGG - Intronic
956214396 3:66833499-66833521 CTCTCTTTGTCCTCCTCCCATGG + Intergenic
956539457 3:70319531-70319553 CTCTCTCTGTCCTCCTGTGACGG + Intergenic
956835657 3:73094381-73094403 CACTCCCTGTCTTCCCCTCCTGG + Intergenic
956908710 3:73794751-73794773 CTCTCTCTCTCTGCTTCTCAGGG - Intergenic
957103503 3:75857218-75857240 CACTGTCTGTCTTTCTCAGAGGG + Intergenic
957827237 3:85463783-85463805 CATTTTCTGTTTTTCTCTCAAGG + Intronic
958574625 3:95932298-95932320 CATTCTCCTTCTACCTCTCATGG - Intergenic
959416122 3:106077984-106078006 AACTCTCTGTACTGCTCTCATGG + Intergenic
960537337 3:118828314-118828336 CACTCTCTCTCTTCAGCACAGGG - Intergenic
960705145 3:120474514-120474536 CCCGCTCTGAGTTCCTCTCATGG - Intergenic
960742593 3:120851413-120851435 CAATCTCTGTCTTCAAATCAGGG + Intergenic
961624172 3:128248146-128248168 CAATTTCTCTCTTCCTCTCTAGG + Intronic
962048382 3:131785681-131785703 CTCTCTCTCTCTCTCTCTCATGG + Intronic
962148250 3:132864611-132864633 CTCTCTCTGTCTGCATCACAGGG + Intergenic
962269184 3:133965721-133965743 CTCCCTCTGTCTTCTTCTCAGGG + Intronic
962810104 3:138952232-138952254 CTCTCTCTGGCATCCCCTCATGG - Exonic
962876929 3:139542254-139542276 GACACTCTGACTACCTCTCAGGG + Intergenic
964302970 3:155309848-155309870 CACTCGCTCTCCTCCTGTCACGG - Intergenic
965439145 3:168691599-168691621 CTCTCTCTTTCATCCTGTCATGG + Intergenic
967055382 3:185825230-185825252 CTCCCTCTCTCTCCCTCTCAAGG + Intergenic
967228112 3:187312502-187312524 CTCTCTCTCTCTCCCTCTCCTGG + Intergenic
967321478 3:188199196-188199218 CCCTCTCTCCCTTCCTCTCAAGG - Intronic
967341980 3:188408418-188408440 CACCCACTGTCTTACTCTCTAGG + Intronic
967373658 3:188776540-188776562 GACTCATTGTCTTCCTCTGATGG + Intronic
967471446 3:189866751-189866773 CACACTCTGTCTTCCTGTGATGG - Exonic
967563729 3:190948652-190948674 CATTCTCTGTTCTTCTCTCACGG - Intergenic
967666633 3:192180516-192180538 CAGCCTCTGTCTTCCTTTCTTGG + Intronic
968038579 3:195569370-195569392 CTCTCTCTGTCTCTCTCTCTGGG - Intronic
968038602 3:195569556-195569578 CACATTCTGCCTTCCTCTCGTGG + Intronic
968548337 4:1209993-1210015 CAGTGTCTGGCTGCCTCTCAGGG + Intergenic
969344256 4:6561331-6561353 CACTCTCTCTCCGCCTGTCATGG - Intronic
969697043 4:8740835-8740857 CACCCTCAGTCTGCCCCTCATGG + Intergenic
969753956 4:9135199-9135221 CTCTCTCTCTCTCTCTCTCACGG + Intergenic
971835698 4:31760200-31760222 TACTCTGTTTCTTCCTCTCTTGG + Intergenic
971838700 4:31803246-31803268 CTTTCTCTGTCTCCATCTCAGGG + Intergenic
971838779 4:31804135-31804157 CTCTCTCTCTCTCTCTCTCAAGG - Intergenic
972861899 4:43179557-43179579 CTCTCTCTGTCTTCTTATAAGGG + Intergenic
975234528 4:71976747-71976769 CTCTCTCTGTCTTTTCCTCAGGG + Intergenic
975389413 4:73799208-73799230 CTCTCTCTGTCTTTCTATGATGG - Intergenic
975464589 4:74694853-74694875 CACTATCTTCCTTCCTTTCATGG + Intergenic
975838275 4:78447681-78447703 CACTCACTGTCTTTCTCTTAGGG - Intronic
975925940 4:79453650-79453672 CTCTCGTTCTCTTCCTCTCAGGG + Intergenic
977492139 4:97729079-97729101 CTCTCTCTCTCTCTCTCTCAGGG + Intronic
978603718 4:110455966-110455988 AGTTCTCTGTCTTCCTCTAATGG - Intronic
978992617 4:115104316-115104338 CACCATCTGTCTCCTTCTCAAGG - Intronic
980740092 4:136939190-136939212 CACTTTCTGTGTCTCTCTCAAGG - Intergenic
981511219 4:145560962-145560984 CATTGTCTGTCATCCTCCCAAGG + Intergenic
981947501 4:150365334-150365356 CATTCTCTGTCTTGCTCTAAAGG - Intronic
983354993 4:166645565-166645587 CACTCACTCTCCTCCTCTCATGG + Intergenic
984024959 4:174531826-174531848 CTCTCTCCTTCTTCCTCTCCTGG - Intergenic
984398890 4:179236088-179236110 CTCTCTTTGTCTTACTCTCCAGG - Intergenic
986144427 5:5064158-5064180 CTCTGTCTCTCTTTCTCTCATGG - Intergenic
988093351 5:26569718-26569740 CACTCTCTGACCTCCCCTCTAGG + Intergenic
988196729 5:28014160-28014182 CACTCTCAGTCTTTCCCTAAAGG - Intergenic
988892873 5:35638314-35638336 CAGTCTCTCTGTTGCTCTCAAGG + Intronic
990058056 5:51610717-51610739 CACTCTGTGTCTTCTACTCTAGG - Intergenic
990446019 5:55895267-55895289 AACTCTCTGCTTTCCTCTCATGG + Intronic
990851048 5:60205225-60205247 CAGGCTCTGTCTTCCTGTGATGG + Intronic
990871410 5:60434813-60434835 CTCTCTCTCCCTTGCTCTCAGGG + Intronic
991982266 5:72244881-72244903 CTCTCTCTCTCTTACTTTCATGG + Intronic
994565412 5:101439853-101439875 CTCTCTCTGTCTTTCAGTCAGGG + Intergenic
994870644 5:105345792-105345814 CACTCACTGAGTTCCTCCCAGGG + Intergenic
994979980 5:106861776-106861798 CACTCTCAGTCTTCCTGTCAAGG + Intergenic
995063667 5:107837954-107837976 CACTGTATGTCTTCTACTCACGG - Intergenic
995188184 5:109292749-109292771 CACTCTGTGTCTTTCAATCAGGG - Intergenic
995303870 5:110620671-110620693 CTCTCTCTCTCTCCCTCTCTCGG + Intronic
997035155 5:130181458-130181480 CTCTCTCTGTCTCTCTCTCCAGG + Intronic
998291070 5:140915638-140915660 CTCTCTCTCTCTCTCTCTCAAGG + Intronic
998931624 5:147187794-147187816 CACTGTCTGTTTTAGTCTCAAGG + Intergenic
999523735 5:152380241-152380263 CTCTCTCTCTCTCCCTCTCTTGG - Intergenic
999566727 5:152871944-152871966 CACTCACTGTCACCCTGTCAAGG - Intergenic
999617914 5:153444531-153444553 CTCTCTCTCTCTCTCTCTCAGGG - Intergenic
1002102588 5:176864809-176864831 CCCTCTCTATCTCCCTCTGAGGG - Intronic
1002193485 5:177490592-177490614 CCCTCTCTCTCTGCCCCTCAGGG - Intronic
1003426290 6:6000187-6000209 CACCCTCTGTCCTCCTCTTGCGG + Intronic
1003508348 6:6758733-6758755 CACACACTGTTTTCCTCTCTGGG - Intergenic
1005027245 6:21474920-21474942 CACTCTCTGTCTTTATCTCATGG - Intergenic
1006453529 6:34119389-34119411 CTCTCTCTTTCTTTCTTTCATGG - Intronic
1007312134 6:40955055-40955077 CAGTCTGTGTCTTCCCATCATGG - Intergenic
1007840730 6:44713997-44714019 CTCTCTGTGTCCTCCTCACATGG + Intergenic
1009336907 6:62502339-62502361 CCTTCTCTGTATTCCTCACATGG - Intergenic
1009549904 6:65076719-65076741 CATTCTCTCTCCTCCTCTCATGG + Intronic
1010364684 6:75035825-75035847 CTCTCTCTCTCTTTGTCTCATGG - Intergenic
1011090302 6:83590348-83590370 CACACTTTGTCTTGCTCCCAAGG + Intronic
1011941722 6:92850707-92850729 CAAGCTCTGTGTTCCTCCCAGGG + Intergenic
1012369638 6:98487646-98487668 CTCTCACTCTCTTTCTCTCAGGG + Intergenic
1013003644 6:106049605-106049627 CCCTCCCTGTCTTCCTCTCCTGG + Intergenic
1013126950 6:107193096-107193118 CACGTTCTGTTTTCCCCTCAGGG - Intronic
1013669355 6:112382234-112382256 CCCTCTCTCTCATCTTCTCATGG + Intergenic
1015305729 6:131705093-131705115 CCCTCTCTCTCTTCCTCTTCTGG - Intronic
1017051677 6:150399473-150399495 CACCTTCTGTCGTCCTCCCAGGG + Exonic
1018479775 6:164178780-164178802 CAGTCCCTGTTTTCCTCTCAAGG + Intergenic
1019119419 6:169791503-169791525 CACCCTCTTTCTCCCACTCACGG + Intergenic
1019546597 7:1580358-1580380 CTCTCTGTCTCTTTCTCTCACGG + Intergenic
1020134805 7:5581224-5581246 AAATCTCTGGCTTCCTCTCCAGG - Intergenic
1021963603 7:25895792-25895814 CTCTCTCTCTCTTTCTCTCCAGG - Intergenic
1022042982 7:26597886-26597908 CTCTCTCTCTTTTTCTCTCAGGG - Intergenic
1022653503 7:32298271-32298293 CGCTTTCTGTCTCCCTCTCTCGG + Intronic
1022658587 7:32344750-32344772 TATTGTCTGTCTTCCTCTCCAGG + Intergenic
1022684148 7:32578976-32578998 CATTCTCTGTGTTCCTGGCATGG - Intronic
1022716295 7:32901678-32901700 CTCACTCTGTCTTTCTCTCTGGG + Intergenic
1022995808 7:35754389-35754411 CTCTCTCTGTCTTCCCCCCCAGG + Intergenic
1023013005 7:35940039-35940061 CTCTCTCTCTCTCTCTCTCAAGG + Intergenic
1023078483 7:36506062-36506084 CTCTCTCTCTCTTTCTCACAGGG + Intergenic
1024078125 7:45833792-45833814 CTCTCTCTCTCTCTCTCTCAGGG - Intergenic
1024973475 7:55091891-55091913 CTCTCTCTTTCTCTCTCTCAGGG - Intronic
1025126285 7:56347628-56347650 CTCTCTCTCTCTTTCTCTCAGGG + Intergenic
1026319925 7:69259383-69259405 CTCTCTCTTTCTTTCTCTCATGG - Intergenic
1026956196 7:74377699-74377721 CACTCTCTGTCAGCCCCACAGGG - Intronic
1027225948 7:76243750-76243772 CAGTCTCTGTCTCCCTCTGTGGG + Intronic
1027543974 7:79503201-79503223 CTCTCTCTATCTCTCTCTCAAGG + Intergenic
1028163419 7:87511007-87511029 CAGTGTCTGTTTTCCTCCCAGGG - Intronic
1028473278 7:91227386-91227408 CTCTCTCTCTCTCTCTCTCAAGG + Intergenic
1030212887 7:107013770-107013792 CACTCTCTTTCTTCCTTCCCGGG - Intergenic
1031168819 7:118265012-118265034 GACTTTCTGTCTTCCTTACAAGG + Intergenic
1031903960 7:127440493-127440515 CACTTACTGTCTTCCCCACAGGG + Intergenic
1032434523 7:131889216-131889238 CCCTCAGTGTTTTCCTCTCAAGG + Intergenic
1032848456 7:135772020-135772042 CAGTGTCTGTCTGCCTCCCAGGG + Intergenic
1033550222 7:142440022-142440044 CACTAACTGACTTCCTCTCGGGG - Intergenic
1033739843 7:144263324-144263346 CCCTCTCTCTCTTCCTCTTCTGG - Intergenic
1035110352 7:156476375-156476397 CACTCTGTGTCCATCTCTCATGG + Intergenic
1035250667 7:157594854-157594876 CATCCTCTGTCATCCTCTCCTGG - Intronic
1035346070 7:158199362-158199384 CTCTTTCTGGCTTTCTCTCATGG + Intronic
1035814716 8:2527049-2527071 CTCTCTCTGTCTTCCTTGAAGGG + Intergenic
1038043905 8:23750203-23750225 GTCTTTCTGTCTTCCTTTCAGGG + Intergenic
1039247124 8:35621142-35621164 GAGACTCTGTCTTCCTCTCAGGG + Intronic
1039431459 8:37528442-37528464 CTCTCCATATCTTCCTCTCAGGG - Intergenic
1039901250 8:41754030-41754052 TACTCTCTGCCTTCCATTCATGG + Intronic
1041190922 8:55353373-55353395 CAATTTCTGTCTTCTTCACAGGG - Intronic
1041199047 8:55432497-55432519 CACTATCTGTCTTTTTCTAATGG - Intronic
1041706165 8:60848493-60848515 CCCCCTCTGTCTTCCTCTCCAGG + Exonic
1041838736 8:62246090-62246112 CACTCCCTCTCTTCCCCTCAAGG - Intergenic
1042678129 8:71346085-71346107 CTCTCTCTTTCTTCCTGGCATGG + Intronic
1042847391 8:73182174-73182196 CACTCTCTTTCTCCCTCTTCAGG - Intergenic
1043453987 8:80395641-80395663 CTCTCTCTCTCTTTCTCTCTGGG - Intergenic
1045277569 8:100721624-100721646 CACTCGCTCTCCTCCTCTCACGG - Exonic
1046824379 8:118671115-118671137 CACTCCTTGTTTTCCTCTTATGG + Intergenic
1048474080 8:134727471-134727493 CCCTGTCTCTCCTCCTCTCATGG + Intergenic
1049335803 8:142084069-142084091 TTCTCTCTTTCTTCCCCTCATGG - Intergenic
1050665415 9:7930370-7930392 CATACCCTGTCTTTCTCTCAGGG - Intergenic
1051507944 9:17846070-17846092 CACAGTCTGTCTTCCTCAGAAGG - Intergenic
1052723483 9:32201353-32201375 CACTCTTTGTTTATCTCTCATGG - Intergenic
1053447288 9:38162816-38162838 CTTTCTCTATCTTCCTTTCAGGG + Intergenic
1055521636 9:77087338-77087360 CACTGGCCGTCCTCCTCTCAGGG - Intergenic
1055588122 9:77778485-77778507 CACTCTCTTTCTGCCTCTTATGG - Intronic
1055698515 9:78916196-78916218 CACTCTCTGTCCTGCTGCCATGG + Intergenic
1055904597 9:81278092-81278114 AACAGTCTGTCTTCCTCTTAAGG + Intergenic
1056120913 9:83487657-83487679 AAATCTCTTTCTTCCTCTCCAGG - Intronic
1056403310 9:86249240-86249262 CACACTCTGTCTTACTCCCAGGG - Intronic
1056701488 9:88914819-88914841 TGCTCTCTGGCTTCCTCTGATGG + Intergenic
1056745331 9:89296524-89296546 CTCTCTCTCTCTTCCTCACATGG + Intergenic
1057291253 9:93808856-93808878 CCCTCTCAGTCCTCCTCTGAAGG + Intergenic
1057922880 9:99112933-99112955 CTCTCTCTGTCTTTCTCTTTTGG + Intronic
1058048972 9:100387572-100387594 CAGTCTCTGCCATCCTCTCTGGG - Intergenic
1058386654 9:104444497-104444519 CACTCTCTTCCCACCTCTCAGGG + Intergenic
1058892239 9:109371041-109371063 AACCCTCTTCCTTCCTCTCAGGG - Intergenic
1061879979 9:133563785-133563807 CTCTCTCTCTCTGTCTCTCAGGG - Intronic
1062059619 9:134488026-134488048 CTCTCTCTCTCTTTCTTTCATGG + Intergenic
1062066375 9:134528844-134528866 CACTCAGTGTCATGCTCTCAAGG + Intergenic
1062118873 9:134823232-134823254 CCCTCTCTGTTCTCATCTCAAGG + Intronic
1185552141 X:991227-991249 CTGTCTCTGTCTCTCTCTCAAGG + Intergenic
1186748431 X:12595183-12595205 GCCTTTCTGTCTTCCTCACAAGG - Intronic
1186935713 X:14448728-14448750 CTCTCTCTCTCTTTCTCTCTGGG - Intergenic
1187450216 X:19389390-19389412 CCCTCCCTGTGTTCCTCTGAAGG - Intronic
1187614973 X:20982983-20983005 CTCTCTCTCTCTTTCTTTCAGGG - Intergenic
1187640629 X:21285121-21285143 CTCTCTCAGTCTTCCCTTCATGG - Intergenic
1189632999 X:42975023-42975045 CCCTTTCTGTCTTTCTCTCTGGG - Intergenic
1190234307 X:48604251-48604273 CCCACTCTCTCATCCTCTCAGGG + Exonic
1192564123 X:72148806-72148828 CTCTCTCTTTCTCCCTCTCCAGG - Intergenic
1193201167 X:78692759-78692781 CACTCTTTATTTTCTTCTCAGGG - Intergenic
1193460052 X:81779855-81779877 CACTCCCTGTCTTCCTTGCGTGG + Intergenic
1194537640 X:95125759-95125781 CAATGTATGTCTTCCTCTCATGG - Intergenic
1194964128 X:100267941-100267963 CATTCTCTGTCTTGCTGACAAGG - Intergenic
1195627830 X:107021931-107021953 CACTCTTTTTTTTCCTCTAATGG + Intergenic
1196556433 X:117090281-117090303 CACTCTCTTTCTCTCTCTCAAGG + Intergenic
1197079256 X:122393081-122393103 CACTCTCTGTCCCCAGCTCAAGG + Intergenic
1197171772 X:123442990-123443012 CGCTCTGTGTGTTCCTGTCAGGG + Intronic
1197505008 X:127290640-127290662 CTCTCTCTGTCTGTCTCTCCTGG - Intergenic
1198040114 X:132842540-132842562 TTCTCTCTGTCTTTCTCTCTCGG - Intronic
1198564813 X:137893616-137893638 CACTCTATGCCTTCCTCACAGGG - Intergenic
1199081771 X:143585045-143585067 CACTCTCTGTCATCTTTTCCAGG - Intergenic
1199612143 X:149627490-149627512 CTCTCTCTCTCTTCCTCACAAGG + Intronic
1200063946 X:153495978-153496000 CACTCTCTCGCTCCCTCTCCTGG - Intronic
1200684768 Y:6248241-6248263 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1200687394 Y:6268557-6268579 CACTCTCTGTCTTTCTCTCAAGG - Intergenic
1200822915 Y:7606323-7606345 CTCTCTCTCTCTTCCTCAAATGG - Intergenic
1200830801 Y:7687553-7687575 CACTCTCTGTCTTCCTATCAAGG + Intergenic
1200949408 Y:8879652-8879674 CTCTCTCTCTCTCTCTCTCATGG - Intergenic
1200990298 Y:9339506-9339528 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1200992959 Y:9359821-9359843 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1200995613 Y:9380099-9380121 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1200998278 Y:9400445-9400467 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1201000786 Y:9468979-9469001 GTCACTCTGTCTTCCTCTCAAGG - Intronic
1201003454 Y:9489309-9489331 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1201006110 Y:9509591-9509613 CACTCTCTGTCTTCCTCTCAAGG - Intergenic
1201008768 Y:9529904-9529926 CACTCTCTGTCTTCCTCTCAAGG - Intronic
1201011344 Y:9550073-9550095 CACACTCTGTCTTCCTCTCAAGG - Intergenic
1201047879 Y:9906153-9906175 CACTCTCTGTCTTTCTCTCAAGG + Intergenic
1201063229 Y:10067145-10067167 CCCTCTCTGTCTTCCTCTCAAGG + Intergenic
1201419986 Y:13787941-13787963 CACTTACTGTCTTCCTCTTTGGG - Intergenic
1201763482 Y:17561085-17561107 CAGTCCCTGGCTTCCTCCCAGGG - Intergenic
1201838071 Y:18344905-18344927 CAGTCCCTGGCTTCCTCCCAGGG + Intergenic
1202116123 Y:21470100-21470122 CACTCTGTGTCTTCTTCTCAAGG - Intergenic
1202189972 Y:22231578-22231600 CTCTCTCTCTCTTCCTCAAATGG - Intergenic
1202237140 Y:22724776-22724798 CTCTCTCTCTCTTCCTCAAATGG + Intergenic