ID: 1201011348

View in Genome Browser
Species Human (GRCh38)
Location Y:9550102-9550124
Sequence TCCAGGACATTCATGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201011342_1201011348 27 Left 1201011342 Y:9550052-9550074 CCTTTCATACATGTAGAAATTCC No data
Right 1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG No data
1201011341_1201011348 30 Left 1201011341 Y:9550049-9550071 CCTCCTTTCATACATGTAGAAAT No data
Right 1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG No data
1201011344_1201011348 6 Left 1201011344 Y:9550073-9550095 CCTTGAGAGGAAGACAGAGTGTG No data
Right 1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201011348 Original CRISPR TCCAGGACATTCATGGCATT GGG Intergenic
No off target data available for this crispr