ID: 1201017668

View in Genome Browser
Species Human (GRCh38)
Location Y:9622636-9622658
Sequence CAGTATTTGAAACATGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201017668_1201017670 15 Left 1201017668 Y:9622636-9622658 CCTGAAACATGTTTCAAATACTG No data
Right 1201017670 Y:9622674-9622696 GACAATTACAGTTTTTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201017668 Original CRISPR CAGTATTTGAAACATGTTTC AGG (reversed) Intergenic
No off target data available for this crispr