ID: 1201018163

View in Genome Browser
Species Human (GRCh38)
Location Y:9625333-9625355
Sequence CAGACACAGAAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201018163_1201018168 2 Left 1201018163 Y:9625333-9625355 CCTGACCACTTCTTCTGTGTCTG No data
Right 1201018168 Y:9625358-9625380 CCTGGTCAGAGCACGCTGTCTGG No data
1201018163_1201018172 30 Left 1201018163 Y:9625333-9625355 CCTGACCACTTCTTCTGTGTCTG No data
Right 1201018172 Y:9625386-9625408 CAAGACCACCACAGCCGCGATGG No data
1201018163_1201018169 3 Left 1201018163 Y:9625333-9625355 CCTGACCACTTCTTCTGTGTCTG No data
Right 1201018169 Y:9625359-9625381 CTGGTCAGAGCACGCTGTCTGGG No data
1201018163_1201018170 6 Left 1201018163 Y:9625333-9625355 CCTGACCACTTCTTCTGTGTCTG No data
Right 1201018170 Y:9625362-9625384 GTCAGAGCACGCTGTCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201018163 Original CRISPR CAGACACAGAAGAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr