ID: 1201020115

View in Genome Browser
Species Human (GRCh38)
Location Y:9647546-9647568
Sequence TTCTCTCTCTAATCTAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201020115_1201020118 20 Left 1201020115 Y:9647546-9647568 CCTAGCCTAGATTAGAGAGAGAA No data
Right 1201020118 Y:9647589-9647611 AGTTATTTATTATTCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201020115 Original CRISPR TTCTCTCTCTAATCTAGGCT AGG (reversed) Intergenic
No off target data available for this crispr