ID: 1201023619

View in Genome Browser
Species Human (GRCh38)
Location Y:9683606-9683628
Sequence TAGCATAACTCAAATAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201023615_1201023619 -8 Left 1201023615 Y:9683591-9683613 CCCTGGTGCCATGGCTAGCATAA No data
Right 1201023619 Y:9683606-9683628 TAGCATAACTCAAATAGTGGAGG No data
1201023616_1201023619 -9 Left 1201023616 Y:9683592-9683614 CCTGGTGCCATGGCTAGCATAAC No data
Right 1201023619 Y:9683606-9683628 TAGCATAACTCAAATAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201023619 Original CRISPR TAGCATAACTCAAATAGTGG AGG Intergenic
No off target data available for this crispr