ID: 1201024193

View in Genome Browser
Species Human (GRCh38)
Location Y:9690595-9690617
Sequence AGGTGTCTGCAAAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201024193_1201024198 -6 Left 1201024193 Y:9690595-9690617 CCAGCCATCTTTTGCAGACACCT No data
Right 1201024198 Y:9690612-9690634 ACACCTGCCTCTGGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201024193 Original CRISPR AGGTGTCTGCAAAAGATGGC TGG (reversed) Intergenic
No off target data available for this crispr