ID: 1201026071

View in Genome Browser
Species Human (GRCh38)
Location Y:9705302-9705324
Sequence AATGCAGCCAGCCTACCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201026071_1201026073 -5 Left 1201026071 Y:9705302-9705324 CCTTCAGGTAGGCTGGCTGCATT No data
Right 1201026073 Y:9705320-9705342 GCATTTCAAGTTGTGGATCATGG No data
1201026071_1201026074 6 Left 1201026071 Y:9705302-9705324 CCTTCAGGTAGGCTGGCTGCATT No data
Right 1201026074 Y:9705331-9705353 TGTGGATCATGGTCTCGTTGTGG No data
1201026071_1201026075 9 Left 1201026071 Y:9705302-9705324 CCTTCAGGTAGGCTGGCTGCATT No data
Right 1201026075 Y:9705334-9705356 GGATCATGGTCTCGTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201026071 Original CRISPR AATGCAGCCAGCCTACCTGA AGG (reversed) Intergenic
No off target data available for this crispr