ID: 1201026073

View in Genome Browser
Species Human (GRCh38)
Location Y:9705320-9705342
Sequence GCATTTCAAGTTGTGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201026071_1201026073 -5 Left 1201026071 Y:9705302-9705324 CCTTCAGGTAGGCTGGCTGCATT No data
Right 1201026073 Y:9705320-9705342 GCATTTCAAGTTGTGGATCATGG No data
1201026065_1201026073 20 Left 1201026065 Y:9705277-9705299 CCAGCGATTTTAGGGAGCAAAAG No data
Right 1201026073 Y:9705320-9705342 GCATTTCAAGTTGTGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201026073 Original CRISPR GCATTTCAAGTTGTGGATCA TGG Intergenic
No off target data available for this crispr