ID: 1201026073 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:9705320-9705342 |
| Sequence | GCATTTCAAGTTGTGGATCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201026071_1201026073 | -5 | Left | 1201026071 | Y:9705302-9705324 | CCTTCAGGTAGGCTGGCTGCATT | No data | ||
| Right | 1201026073 | Y:9705320-9705342 | GCATTTCAAGTTGTGGATCATGG | No data | ||||
| 1201026065_1201026073 | 20 | Left | 1201026065 | Y:9705277-9705299 | CCAGCGATTTTAGGGAGCAAAAG | No data | ||
| Right | 1201026073 | Y:9705320-9705342 | GCATTTCAAGTTGTGGATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201026073 | Original CRISPR | GCATTTCAAGTTGTGGATCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||