ID: 1201027561

View in Genome Browser
Species Human (GRCh38)
Location Y:9716889-9716911
Sequence CCTGAAGGGTCCCTGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201027549_1201027561 9 Left 1201027549 Y:9716857-9716879 CCTCCTCCAGCAGAACCTAACCA No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data
1201027550_1201027561 6 Left 1201027550 Y:9716860-9716882 CCTCCAGCAGAACCTAACCACCA No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data
1201027547_1201027561 30 Left 1201027547 Y:9716836-9716858 CCTCACAGTCACAAAATGCCTCC No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data
1201027548_1201027561 12 Left 1201027548 Y:9716854-9716876 CCTCCTCCTCCAGCAGAACCTAA No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data
1201027551_1201027561 3 Left 1201027551 Y:9716863-9716885 CCAGCAGAACCTAACCACCACGA No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data
1201027553_1201027561 -6 Left 1201027553 Y:9716872-9716894 CCTAACCACCACGATGGCCTGAA No data
Right 1201027561 Y:9716889-9716911 CCTGAAGGGTCCCTGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201027561 Original CRISPR CCTGAAGGGTCCCTGAGGTC GGG Intergenic
No off target data available for this crispr