ID: 1201028290 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:9723103-9723125 |
| Sequence | CTGCCTATGCTCAAGGAGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201028283_1201028290 | 28 | Left | 1201028283 | Y:9723052-9723074 | CCACAGATTAGCTGCCAGTGATT | No data | ||
| Right | 1201028290 | Y:9723103-9723125 | CTGCCTATGCTCAAGGAGGTGGG | No data | ||||
| 1201028284_1201028290 | 14 | Left | 1201028284 | Y:9723066-9723088 | CCAGTGATTTCAAACAGCAAATG | No data | ||
| Right | 1201028290 | Y:9723103-9723125 | CTGCCTATGCTCAAGGAGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201028290 | Original CRISPR | CTGCCTATGCTCAAGGAGGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||