ID: 1201028290

View in Genome Browser
Species Human (GRCh38)
Location Y:9723103-9723125
Sequence CTGCCTATGCTCAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201028283_1201028290 28 Left 1201028283 Y:9723052-9723074 CCACAGATTAGCTGCCAGTGATT No data
Right 1201028290 Y:9723103-9723125 CTGCCTATGCTCAAGGAGGTGGG No data
1201028284_1201028290 14 Left 1201028284 Y:9723066-9723088 CCAGTGATTTCAAACAGCAAATG No data
Right 1201028290 Y:9723103-9723125 CTGCCTATGCTCAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201028290 Original CRISPR CTGCCTATGCTCAAGGAGGT GGG Intergenic
No off target data available for this crispr