ID: 1201028619

View in Genome Browser
Species Human (GRCh38)
Location Y:9725673-9725695
Sequence CTGACTATGCTGTAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201028614_1201028619 14 Left 1201028614 Y:9725636-9725658 CCAAAAACTTCAGGAACCAAAAA No data
Right 1201028619 Y:9725673-9725695 CTGACTATGCTGTAGGTTGTGGG No data
1201028616_1201028619 -2 Left 1201028616 Y:9725652-9725674 CCAAAAAGGATTTTTTCTATGCT No data
Right 1201028619 Y:9725673-9725695 CTGACTATGCTGTAGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201028619 Original CRISPR CTGACTATGCTGTAGGTTGT GGG Intergenic
No off target data available for this crispr