ID: 1201030586

View in Genome Browser
Species Human (GRCh38)
Location Y:9742484-9742506
Sequence AACAAAAGTTTCCCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201030586_1201030591 4 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030591 Y:9742511-9742533 CACCGTTATCAGAGGGCTGCAGG No data
1201030586_1201030592 5 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030592 Y:9742512-9742534 ACCGTTATCAGAGGGCTGCAGGG No data
1201030586_1201030588 -3 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030588 Y:9742504-9742526 GTTCTCCCACCGTTATCAGAGGG No data
1201030586_1201030596 27 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030596 Y:9742534-9742556 GTTCGTGAAGGAGGAGAACCAGG No data
1201030586_1201030595 18 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030595 Y:9742525-9742547 GGCTGCAGGGTTCGTGAAGGAGG No data
1201030586_1201030594 15 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030594 Y:9742522-9742544 GAGGGCTGCAGGGTTCGTGAAGG No data
1201030586_1201030587 -4 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030587 Y:9742503-9742525 TGTTCTCCCACCGTTATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201030586 Original CRISPR AACAAAAGTTTCCCTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr