ID: 1201030591

View in Genome Browser
Species Human (GRCh38)
Location Y:9742511-9742533
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201030586_1201030591 4 Left 1201030586 Y:9742484-9742506 CCAGCAACAGGGAAACTTTTGTT No data
Right 1201030591 Y:9742511-9742533 CACCGTTATCAGAGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201030591 Original CRISPR CACCGTTATCAGAGGGCTGC AGG Intergenic
No off target data available for this crispr