ID: 1201034545

View in Genome Browser
Species Human (GRCh38)
Location Y:9774095-9774117
Sequence CAAGAATGTGAGCTGATCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034545_1201034553 27 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data
1201034545_1201034552 26 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034552 Y:9774144-9774166 GGCCATGGAGATGCCATGAAGGG No data
1201034545_1201034551 25 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data
1201034545_1201034547 5 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034547 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
1201034545_1201034549 11 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034549 Y:9774129-9774151 TCTCCAGCATGACATGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034545 Original CRISPR CAAGAATGTGAGCTGATCGC TGG (reversed) Intergenic
No off target data available for this crispr