ID: 1201034546

View in Genome Browser
Species Human (GRCh38)
Location Y:9774123-9774145
Sequence CCATGTCATGCTGGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034546_1201034552 -2 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034552 Y:9774144-9774166 GGCCATGGAGATGCCATGAAGGG No data
1201034546_1201034557 20 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034546_1201034551 -3 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data
1201034546_1201034555 7 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data
1201034546_1201034553 -1 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034546 Original CRISPR CCATGTCATGCTGGAGAAGG AGG (reversed) Intergenic