ID: 1201034548

View in Genome Browser
Species Human (GRCh38)
Location Y:9774126-9774148
Sequence TGGCCATGTCATGCTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034548_1201034552 -5 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034552 Y:9774144-9774166 GGCCATGGAGATGCCATGAAGGG No data
1201034548_1201034557 17 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034548_1201034551 -6 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data
1201034548_1201034555 4 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data
1201034548_1201034563 29 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG No data
1201034548_1201034561 28 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data
1201034548_1201034553 -4 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034548 Original CRISPR TGGCCATGTCATGCTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr