ID: 1201034550

View in Genome Browser
Species Human (GRCh38)
Location Y:9774132-9774154
Sequence TCTCCATGGCCATGTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034550_1201034553 -10 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data
1201034550_1201034557 11 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034550_1201034563 23 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG No data
1201034550_1201034555 -2 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data
1201034550_1201034561 22 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034550 Original CRISPR TCTCCATGGCCATGTCATGC TGG (reversed) Intergenic
No off target data available for this crispr