ID: 1201034551

View in Genome Browser
Species Human (GRCh38)
Location Y:9774143-9774165
Sequence TGGCCATGGAGATGCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034545_1201034551 25 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data
1201034546_1201034551 -3 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data
1201034548_1201034551 -6 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034551 Y:9774143-9774165 TGGCCATGGAGATGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034551 Original CRISPR TGGCCATGGAGATGCCATGA AGG Intergenic
No off target data available for this crispr