ID: 1201034553

View in Genome Browser
Species Human (GRCh38)
Location Y:9774145-9774167
Sequence GCCATGGAGATGCCATGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034546_1201034553 -1 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data
1201034548_1201034553 -4 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data
1201034550_1201034553 -10 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data
1201034545_1201034553 27 Left 1201034545 Y:9774095-9774117 CCAGCGATCAGCTCACATTCTTG No data
Right 1201034553 Y:9774145-9774167 GCCATGGAGATGCCATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034553 Original CRISPR GCCATGGAGATGCCATGAAG GGG Intergenic
No off target data available for this crispr