ID: 1201034555

View in Genome Browser
Species Human (GRCh38)
Location Y:9774153-9774175
Sequence GATGCCATGAAGGGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034546_1201034555 7 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data
1201034548_1201034555 4 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data
1201034550_1201034555 -2 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034555 Y:9774153-9774175 GATGCCATGAAGGGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034555 Original CRISPR GATGCCATGAAGGGGCCCTG AGG Intergenic
No off target data available for this crispr