ID: 1201034556

View in Genome Browser
Species Human (GRCh38)
Location Y:9774157-9774179
Sequence GGGACCTCAGGGCCCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034556_1201034565 8 Left 1201034556 Y:9774157-9774179 CCATGAAGGGGCCCTGAGGTCCC No data
Right 1201034565 Y:9774188-9774210 GTCCCACAGTGGGATTTCACAGG No data
1201034556_1201034563 -2 Left 1201034556 Y:9774157-9774179 CCATGAAGGGGCCCTGAGGTCCC No data
Right 1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG No data
1201034556_1201034561 -3 Left 1201034556 Y:9774157-9774179 CCATGAAGGGGCCCTGAGGTCCC No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034556 Original CRISPR GGGACCTCAGGGCCCCTTCA TGG (reversed) Intergenic
No off target data available for this crispr