ID: 1201034557

View in Genome Browser
Species Human (GRCh38)
Location Y:9774166-9774188
Sequence GGCCCTGAGGTCCCCACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034550_1201034557 11 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034548_1201034557 17 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034546_1201034557 20 Left 1201034546 Y:9774123-9774145 CCTCCTTCTCCAGCATGACATGG No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data
1201034554_1201034557 -3 Left 1201034554 Y:9774146-9774168 CCATGGAGATGCCATGAAGGGGC No data
Right 1201034557 Y:9774166-9774188 GGCCCTGAGGTCCCCACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034557 Original CRISPR GGCCCTGAGGTCCCCACTTA TGG Intergenic
No off target data available for this crispr