ID: 1201034561

View in Genome Browser
Species Human (GRCh38)
Location Y:9774177-9774199
Sequence CCCCACTTATGGTCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201034550_1201034561 22 Left 1201034550 Y:9774132-9774154 CCAGCATGACATGGCCATGGAGA No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data
1201034548_1201034561 28 Left 1201034548 Y:9774126-9774148 CCTTCTCCAGCATGACATGGCCA No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data
1201034556_1201034561 -3 Left 1201034556 Y:9774157-9774179 CCATGAAGGGGCCCTGAGGTCCC No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data
1201034554_1201034561 8 Left 1201034554 Y:9774146-9774168 CCATGGAGATGCCATGAAGGGGC No data
Right 1201034561 Y:9774177-9774199 CCCCACTTATGGTCCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201034561 Original CRISPR CCCCACTTATGGTCCCACAG TGG Intergenic
No off target data available for this crispr