ID: 1201038821

View in Genome Browser
Species Human (GRCh38)
Location Y:9808975-9808997
Sequence TAGAACTAGAGTTTCCTTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201038821_1201038826 25 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038826 Y:9809023-9809045 ATATCTGCTGAGTGAGAAGCAGG No data
1201038821_1201038822 -10 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038822 Y:9808988-9809010 TCTAGTTCTATCACTTCTATTGG No data
1201038821_1201038825 -7 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038825 Y:9808991-9809013 AGTTCTATCACTTCTATTGGGGG No data
1201038821_1201038823 -9 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038823 Y:9808989-9809011 CTAGTTCTATCACTTCTATTGGG No data
1201038821_1201038824 -8 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038824 Y:9808990-9809012 TAGTTCTATCACTTCTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201038821 Original CRISPR TAGAACTAGAGTTTCCTTGT CGG (reversed) Intergenic