ID: 1201038824

View in Genome Browser
Species Human (GRCh38)
Location Y:9808990-9809012
Sequence TAGTTCTATCACTTCTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201038820_1201038824 -5 Left 1201038820 Y:9808972-9808994 CCACCGACAAGGAAACTCTAGTT No data
Right 1201038824 Y:9808990-9809012 TAGTTCTATCACTTCTATTGGGG No data
1201038821_1201038824 -8 Left 1201038821 Y:9808975-9808997 CCGACAAGGAAACTCTAGTTCTA No data
Right 1201038824 Y:9808990-9809012 TAGTTCTATCACTTCTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201038824 Original CRISPR TAGTTCTATCACTTCTATTG GGG Intergenic