ID: 1201039673

View in Genome Browser
Species Human (GRCh38)
Location Y:9818725-9818747
Sequence TCTGATATTCAGCCTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201039667_1201039673 -1 Left 1201039667 Y:9818703-9818725 CCACTAAACTGCCTAAACTGCCT No data
Right 1201039673 Y:9818725-9818747 TCTGATATTCAGCCTGGGGATGG No data
1201039665_1201039673 18 Left 1201039665 Y:9818684-9818706 CCAGCAACTTCATCCTTAACCAC No data
Right 1201039673 Y:9818725-9818747 TCTGATATTCAGCCTGGGGATGG No data
1201039666_1201039673 5 Left 1201039666 Y:9818697-9818719 CCTTAACCACTAAACTGCCTAAA No data
Right 1201039673 Y:9818725-9818747 TCTGATATTCAGCCTGGGGATGG No data
1201039664_1201039673 28 Left 1201039664 Y:9818674-9818696 CCAGTTAGAGCCAGCAACTTCAT No data
Right 1201039673 Y:9818725-9818747 TCTGATATTCAGCCTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201039673 Original CRISPR TCTGATATTCAGCCTGGGGA TGG Intergenic
No off target data available for this crispr