ID: 1201043990

View in Genome Browser
Species Human (GRCh38)
Location Y:9867046-9867068
Sequence ATCAAGAAGAAGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201043985_1201043990 7 Left 1201043985 Y:9867016-9867038 CCAGGATGACTGAGTTCCTCCAC No data
Right 1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG No data
1201043986_1201043990 -9 Left 1201043986 Y:9867032-9867054 CCTCCACCTGTCTGATCAAGAAG No data
Right 1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG No data
1201043983_1201043990 17 Left 1201043983 Y:9867006-9867028 CCGCCGGTAACCAGGATGACTGA No data
Right 1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG No data
1201043984_1201043990 14 Left 1201043984 Y:9867009-9867031 CCGGTAACCAGGATGACTGAGTT No data
Right 1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG No data
1201043982_1201043990 21 Left 1201043982 Y:9867002-9867024 CCAGCCGCCGGTAACCAGGATGA No data
Right 1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201043990 Original CRISPR ATCAAGAAGAAGAAAGAGGA TGG Intergenic
No off target data available for this crispr